Purification of IC140

All reagents, unless stated otherwise, were from Sigma Chemical (St. Louis, MO). For cloning IC140, our strategy was first to obtain partial amino acid sequence from the isolated protein and then to design degenerate primers for reverse transcription (RT)-PCR. Axonemes were isolated from pf28 cells, and dynein extraction and sucrose gradient fractionation were carried out as described previously (Smith and Sale, 1992). For sucrose gradients, the dynein-containing extracts were first dialyzed into buffer A (10 mM HEPES, 5 mM MgSO₄, 1 mM DTT, 0.5 mM EDTA, 30 mM NaCl, 0.1 mM PMSF, 0.6 trypsin inhibitor units aprotinin, pH 7.4), followed by sedimentation through 5–20% sucrose gradients prepared in buffer A. The I1 dynein fractions sedimenting between 18 and 21S were identified by SDS-PAGE and silver staining and concentrated by centrifugation in an Ultrafree-CL Polysulfone filter unit (Millipore, Bedford, MA). The concentrated sample was resolved by 7% SDS-PAGE and then transferred onto a polyvinylidene difluoride membrane (Applied Biosystems, Foster City, CA) in 10 mM 3-[cyclohexylamino]-1-propane sulfonic acid/10% methanol, pH 11. The IC140 band was detected on the membrane by Amido Black staining (0.1% in 1% acetic acid/40% methanol), excised, and shipped to Dr. J. Leszyk (University of Massachusetts, Worcester, MA; formerly the Worcester Foundation for Experimental Biology) for peptide microsequencing. Briefly, the membrane bearing the IC140 protein was exposed to endoproteinase lys-C, and the resulting peptides were eluted and fractionated by HPLC. Three peak fractions were selected and sequenced with an Applied Biosystems Procise Sequencer (see Table ​Table11).

Molecular Biology

For cloning, total RNA was derived from cells before (control) or 45 min after deflagellation, a process that up-regulates the transcription of many flagellar genes (Lefebvre and Rosenbaum, 1986). Genomic DNA was prepared as described (Wilkerson et al., 1994). Poly(A) RNA was further purified with oligo(dT) cellulose (Collaborative Biochemical Products, Bedford, MA) following the methods of Schnell and Lefebvre (1993). Primers for RT-PCR used for various cloning steps (Figure ​(Figure1)1) include P1S (CGCGGAATTCATGACIGACACICARTTY), P3A (CGCGGGATCCAISWICCIGCRTARAACAT), RT1 (TTGCCCTTCTTCAGCAGCTTCTCA), Cr5 (GCGTGTCCGTCATGAATCGGTGCTT), FUS (CGCTACCAGAGGACTACGTG), FUSrev (CGTAGTCCTCTGGTAGCG), and T3 (CTCCTTGCTAGGGATCTG).

Open in a separate window

Figure 1

Schematic picture illustrates the strategy and steps used to clone Chlamydomonas IC140 gene and message. The 11.5-kb XbaI genomic subclone contains the complete IC140 gene consisting of 14 exons (solid bars) and 13 introns. Open boxes indicate 5′ and 3′ untranslated regions. Arrows indicate the position and the direction of primers for RT-PCR (see MATERIALS AND METHODS). The pC1 clone was recovered from screening a cDNA library. PC2 and pC3 resulted from RT-PCR using the gene-specific primer RT1 for reverse transcription and primer pairs FUS/Cr5 and T3/FUSrev, respectively (see RESULTS for details).

RT was primed either with oligo(dT)_12–18 (Pharmacia Biotech, Piscataway, NJ) or with the gene-specific primers (RT1) using the reverse transcriptase Superscript II (Life Technologies, Gaithersburg, MD) according to the manufacturer’s instructions. Each 50-μl PCR reaction contained 0.5 μl RT mixture, 0.2 mM dNTP, a 0.2 μM concentration of each primer (2 μM for degenerate primers), 2.5 U Taq or 1.25 U Pfu DNA polymerase (Strategene, La Jolla, CA) and 1× manufacturer-provided buffer. The PCR mixture was initially denatured at 95°C for 3 min, followed by 35 cycles of 95°C, 1.5 min, 48–50°C, 1.5 min, and 72°C, 3 min. The reaction mixture was maintained at 72°C for an additional 10 min, followed by separation of products in 0.8–1% agarose (Fisher Scientific, Pittsburgh, PA). Notably, after extensive experimentation and numerous primers, we found that RT-PCR, using the gene-specific primer RT1, was optimal when dGTP was replaced with 7-deaza-2′-dGTP/dGTP (3:1; see Innis, 1990) and that the sample was treated with RNAse H after reverse transcription. These steps resulted in the 1.55-kb RT-PCR product known as pC2. The bands of interest were excised and spun through siliconized glass wool. The DNA in the flow through was extracted with phenol-chloroform and precipitated with ethanol. Most purified PCR products were then blunt end cloned into the SmaI site of pBluescript II KS(−). The 350-bp product primed with P1S/P3A was cloned into the EcoRI and BamHI sites.

Library Screening

To obtain cDNA clones containing IC140 sequence, we screened a λzapII cDNA library, made from RNA derived from cells regenerating flagella (kindly provided by K. Wilkerson and G. Witman, University of Massachusetts; Wilkerson et al., 1995). To obtain genomic clones containing IC140 sequence, a λfixII genomic library, constructed from strain A54-e18, was screened (kindly provided by E. Smith and P. Lefebvre, University of Minnesota, Minneapolis, MN; Smith and Lefebvre, 1997). For screening, libraries were plated and transferred to Hybond N filters (Amersham International, Buckinghamshire, UK), followed by UV cross-linking with Strata-linker (Strategene). Positive clones were identified by hybridizing the filters with the [P³²]dCTP-labeled, random-primed probes using the 350-bp PCR product as a template and were incubated at 65°C overnight in buffer (1% BSA, 1 mM. EDTA, 0.5 M sodium phosphate buffer, pH 7.5, 7% SDS). The membranes were then washed once at 65°C with 2× SSC/0.1% SDS and three times with 0.2× SSC/0.1% SDS for 20 min each. The cDNA clones from purified plaques were excised with helper phage (Wilkerson et al., 1995). The 1.6-kb insert of cDNA clone pC1 (Figure ​(Figure1)1) was released with EcoRI and XhoI and further digested to a 1-kb 5′ fragment, containing the coding sequence, and a 0.6-kb 3′ fragment. The 1-kb fragment was subcloned and used as a probe for Northern and Southern blots. The inserts from genomic clones were released from phage vector by XbaI digestion and ligated into pBluescript II KS(−). The XbaI genomic clone was further digested with SalI and NotI and subcloned into pBluescript II KS(−) to further facilitate sequencing.

Southern and Northern Blots

For Southern analysis, genomic DNA (5 μg) was digested with restriction endonucleases, fractionated in 0.8% agarose gels, and transferred to a Nytran membrane following the manufacturer’s instructions (Schleicher & Schuell, Keene, NH). For Northern analysis, poly(A) RNA (3 μg) was fractionated in 1.2% formamide-containing gels and transferred to Hybond N+ filters (Amersham). Membranes were probed with the 1-kb EcoRI–NotI fragment of pC1 (Figure ​(Figure1)1) using the procedures described for library membrane lifts.

Fusion Protein and Antibody Production

The 1.6-kb insert from the pC1 cDNA clone was released by EcoRI and XhoI and ligated, in frame, into pET28(a) expression vector (Novagen, Madison, WI). The expression construct was transformed into Escherichia coli strain BL21(DE3) (Novagen). Production of the N-terminal His-tagged fusion protein was induced by 100 mM isopropyl-1-thio-β-d-galactopyranoside, and proteins contained within the inclusion body were solublized in the 6 M urea/imidazole buffer designed for Ni⁺ column affinity purification and according to the manufacturer’s instructions (Novagen). The eluent was slowly dialyzed against PBS (without pressure or stirring) for 20 h. Most of the purified fusion protein was soluble and used as an antigen to produce polyclonal antibodies in rabbits (Spring Valley Laboratories, Sykesville, MD). For Western blots, samples were separated in SDS-PAGE followed by Coomassie blue staining or transferred to a nitrocellulose membrane (Bio-Rad, Hercules, CA) for immunoblot. The membrane was blocked with 5% nonfat dry milk followed by incubation first with anti-IC140 antibody (1:3000–1:6000 dilution) and then with HRP-conjugated goat anti-rabbit secondary antibody (1:5000, Bio-Rad). The antibody reactivity was detected with 4-chloro-1-naphthal and hydrogen peroxide or with enhanced chemiluminescent reagents (Amersham). M. Porter and S. Myster (University of Minnesota) generously provided the antibody to the 1-α heavy chain of inner arm dynein I1 (Myster et al., 1997).

DNA Sequencing and Sequence Analysis

Sequencing of both strands was carried out manually using dideoxy methods with a Sequenase II kit (United States Biochemicals, Cleveland, OH) or in most cases by automated cycle sequencer (ABI 377, Applied Biosystems). Sequence was analyzed using programs from Wisconsin Sequence Analysis Package Incremental Release 8.1 (Genetics Computer Group, Madison, WI). Programs used include CodonPreference to reveal regions of codon bias in genomic sequences, Findpattern to identify the consensus sequence for exon–intron junctions (/GAXXGX.......CAG/, kindly provided by C. Silflow, University of Minnesota), COMPARE for comparing pairs of dynein IC sequences (window, 30; stringency, 18), PileUp for plotting dendrograms, BLAST to search for homologous molecules (Altschul et al., 1990), Motifs to identify WD repeats, and PeptideStructure for predicting the secondary structure. Coiled-coil structures were predicted using the Coils program (Lupas et al., 1991) (with the MTIDK matrix and a window of 21) from Pedros Biomolecular Research Tools (www.public.iastate.edu/~pedro/research_ tools.html). For analysis, default parameters were used unless stated otherwise.

Immunolocalization

Immunofluorescent staining was carried out as described (Johnson and Rosenbaum, 1992) with modification. The cell wall–deficient cells were allowed to attach to the Nalge-Nunc Permanox chamber slide (Fisher Scientific). Immobilized cells were fixed by immersion in −20°C methanol for 10 min, followed by immersion in a blocking buffer composed of 3% BSA in PBS at room temperature. Slides were incubated with either preimmune serum or the anti-IC140 polyclonal antibody, diluted 1:1000 in 1% BSA/PBS, overnight at 4°C, and FITC-conjugated goat anti-rabbit antibody 1:500 (Cappel/INC Pharmaceuticals, Costa Mesa, CA) in 1% BSA/PBS for 2 h. The images were captured by a Zeiss (Thornwood, NY) epifluorescent microscope equipped with an air-cooled charge-coupled device camera (CCD300T; Dage-MTI, Michigan City, IN).

Sequence Analysis

The IC140 gene consists of 14 exons interrupted by 13 introns illustrated in Figures ​Figures11 and ​and3.3. The sequences at the exon–intron junction (Figure ​(Figure3)3) completely conform to those from most known Chlamydomonas nuclear genes. In addition to several stretches of AT-rich segments, a number of “tub box” sequences were found upstream of the transcription initiation site (Figure ​(Figure3).3). It was proposed that the tub box (GCTC[G/C]AAGGC) is involved in the regulation of tubulin transcript during flagellar regeneration and during the cell cycle (Davis and Grossman, 1994). The presence of tub boxes is consistent with the up-regulation of the IC140 transcript after deflagellation as shown by Northern blot (Perrone et al., 1998).

The 3072-bp open reading frame predicts a protein of 1024 amino acids with a mass 110 kDa and a pI of 4.68 (Figure ​(Figure3).3). Similar differences between predicted and measured size were also reported for other axonemal proteins (LeDizet and Piperno, 1995; Ogawa et al., 1995; Koutoulis et al., 1997). However, this difference is probably not due to phosphorylation (Habermacher and Sale, 1997). The N-terminal 125 amino acids of IC140 are particularly rich in G and A (44%), D and E (28%), and P (16%). No basic residues are found in this region. As expected, the top of the list of the homologous proteins revealed by BLAST search includes dynein IC family members (smallest sum probability ranging from 4.4 × 10⁻³¹ to 1.2 × 10⁻¹⁰). The homologous regions between the ICs, summarized as a dot plot in Figure ​Figure4A,4A, are primarily located around and within a set of WD-repeat motifs common to the ICs studied to date (Ogawa et al., 1995; Wilkerson et al., 1995). Analysis from BLAST search, Compare (Figure ​(Figure4A,4A, dot plot), and PileUp (Figure ​(Figure4B,4B, dendrogram) suggests that IC140 is most closely related to sea urchin IC3 and Chlamydomonas IC69 of the outer dynein arm (Mitchell and Kang, 1991; Ogawa et al., 1995). Motif search and initial visual evaluation revealed five WD repeats in the middle of IC140 (Figure ​(Figure3,3, amino acids 461–842). However, closer examination revealed two additional WD repeats, C′ and E′ (Figure ​(Figure5,5, A and B). This assignment of WD repeats is based on the predicted β-sheet position, on the consensus sequence for the WD repeat, and on homologous sequences within the IC family. Based on this new analysis it is possible to assign seven WD/β-sheet repeats in each dynein IC family member, as summarized in Figure ​Figure55 (see DISCUSSION). (IC140, IC69, IC78, and IC2 were selected because these four ICs represent distinct classes of IC.) Notably, the WD repeats of the ICs shown in Figure ​Figure5B5B are located in relatively similar positions. One exception is an unusually long variable region of 100 amino acid (aa) residues between the B and C repeats of IC140 (Figure ​(Figure5B).5B). The variable regions of WD-repeat proteins identified so far consist of 6–94 residues (Neer et al., 1994). Several observations indicate that the long stretch of aa is not a cloning artifact. First, the seventh exon, which contains A and B WD repeats and an 87-aa variable region, is predicted as a continuous strong condon-biased peak. Second, there are no consensus sequences for intron–exon junctions between the B repeat and the end of the seventh exon. Furthermore, the independently recovered pC1 and pC2 overlap and are identical at the 3′ end of the seventh exon. The functional significance of this region remains to be tested.

Open in a separate window

Figure 4

Dot plot (A) and dendrogram (B) reveal the homology among the ICs: IC140 of the Chlamydomonas inner arm dynein I1, IC69 and IC78 of Chlamydomonas outer arm dynein, and IC2C of rat cytoplasmic dynein. The dot plots were generated by the program Compare with a stringency 18 to find 18 similarity matching values in a comparison window size of 30 (Maizel and Lenk, 1981). The dendrogram was compiled by the PileUp program using default parameters.

Open in a separate window

Figure 5

(A) Sequence alignment of the seven predicted WD/β-sheet repeats in dynein ICs. A–E WD repeats were based on the WD consensus structure discussed by Wilkerson et al. (1995). The C′ and E′ repeats were assigned based on β-sheet location discussed in RESULTS and DISCUSSION. The asterisks indicate the consensus amino acid residues for WD repeats (Neer et al., 1994). The underlined asterisk indicates that two of the three residues were required to match the consensus sequence. The residues in the ICs matching the consensus sequence are shown in bold characters. Underlined regions (a–c) correspond to the first three β-strands as seen in the structure of G_βb. The fourth strand (d) is not illustrated, because it is located in the variable region between WD repeats. (B) Schematic depicting the predicted Chou-Fasman β-sheets (sharp sawtooth wave), WD repeats (open oval), and the coiled coils (box) of the IC proteins listed in Figure ​Figure44A.

The regions outside of the WD repeats are mainly composed of α-helices and turns. Analysis with the Coils program predicts two juxtaposed coiled coils (99 and 60% propensity with a window size of 28) in the C terminus (Figure ​(Figure3,3, approximately amino acids 920-1020). With the exceptions of IC78 and IC2, the coiled-coil structure is also found in the other IC members, including the C terminus of IC69, IC3, and the N-terminus of IC2C, a cytoplasmic dynein homologue (Figure ​(Figure5B;5B; see Mitchell and Kang, 1991; Paschal et al., 1992; Ogawa et al., 1995; Wilkerson et al., 1995).

Binding of IC140 to the Axoneme

To explore the function of IC140, fusion protein and antibody probes were produced. A N-terminally 6-His tagged 53-kDa fusion protein was overexpressed in E. coli strain BL21(DE3). The cells were transformed with a pET28 (a) expression vector containing the 1.6-kb cDNA from pC1 (Figure ​(Figure1),1), inserted in frame. This construct contains the C–E′ WD repeats and the C terminus (Figure ​(Figure5B).5B). The fusion protein was purified on an Ni⁺ column and used to raise polyclonal antibodies and for the microtubule binding assays described below. A rabbit polyclonal antibody specifically recognized IC140 on Western blots of isolated dynein I1 (Figure ​(Figure6A)6A) or isolated flagella and axonemes (Figure ​(Figure6,6, A and B). In contrast, the antibody failed to recognize IC138 from the I1 complex (Figure ​(Figure6B),6B), confirming that IC138 and IC140 are distinct proteins (Habermacher and Sale, 1997; King and Dutcher, 1997). Immunofluorescent staining, using the IC140 antibody, revealed an even distribution of IC140 along the length of both flagellar axonemes in wild-type Chlamydomonas (Figure ​(Figure6A,6A, inset). The preimmune serum failed to stain IC140 on immunoblots or by immunoflorescence. Western blots of flagella or axonemes from mutant cells lacking the outer dynein arms, radial spoke heads, central pair apparatus, or the mbo2 gene product were indistinguishable from wild type (Figure ​(Figure6C,6C, oda1, pf17, and mbo2). In contrast, immunoreactivity is detectable but greatly reduced in Western blots of whole axonemes from two strains that fail to assemble the I1 complex (Figure ​(Figure6C,6C, pf9-3 or pf28pf30) using either colorimetric or enhanced chemiluminescence developing reagents (see MATERIALS AND METHODS). In identical blots, immunoreactivity is completely absent in axonemes from ida7, an I1 mutant defective in the gene for IC140 (see Perrone et al., 1998). The low level of IC140 in pf9-3 and pf28pf30, mutants shown to be defective in an HC gene of I1 (Myster et al., 1997), indicates that IC140 can partially assemble independent of other I1 subunits, consistent with a role for IC140 in anchoring the I1 complex to the doublet microtubule cargo.

Open in a separate window

Figure 6

Polyclonal antibody raised against the 53-kDa fusion protein of IC140 specifically recognized IC140. Western blots for Figure ​Figure6,6, A and B, were probed with the anti-IC140 serum followed by HRP-conjugated secondary antibody and colorimetric development. (A) Lane a, wild-type high-salt extract; lane b, pf28 axonemes; lane c, pf28pf30 axonemes; lane d, I1 fraction from sucrose gradient of pf17 dynein extract; lane e, 53-kDa fusion protein. Inset, immunofluorecent microscopy illustrating that IC140 is located along both flagellar axonemes in wild-type Chlamydomonas cells. (B) Lane a, Amido Black staining revealing the proteins of the I1 fraction frompf28 axonemes including 3 ICs: 140, 138, and 97 kDa (dot); lane b, corresponding Western blot of the same 21S fraction. Molecular weight markers (M.) between lanes a and b were used for alignment. (C) Western blots and protein stains of overloaded gels revealed that IC140 is present in minor but detectable quantity in axonemes from pf28pf30 and pf9-3. For comparison, axonemes from control strains oda1, pf17, and mbo2 bear wild-type amounts of IC140. Axonemes (50 μg/lane) were separated in SDS-PAGE (4.5% for α HC, 7% for IC140 and Tubulin). Top panel, Western blot probed with affinity-purified anti-α HC (Myster, et al., 1997). Middle panel, Western blot probed with anti-IC140 serum. Bottom panel, tubulin (25 μg/lane) was revealed by Amido Black staining, showing equal loading of samples.

To further test this hypothesis, we examined whether the purified IC140 fusion protein would bind axonemes. The prediction was that the fusion protein would bind doublet microtubules but only in the absence of endogenous I1 complex, when the presumed I1 anchor would be exposed. Axonemes were isolated from either control cells (pf28, lacking the outer dynein arms but bearing the full compliment of inner dynein arms) or experimental, double mutant cells (pf28pf30, lacking both the outer dynein arms as well as the I1 complex: see Smith and Sale, 1992) and mixed with the 53-kDa fusion protein. After reconstitution, the fusion protein specifically sediments with axonemes derived from pf28pf30 (Figure ​(Figure7).7). In contrast, little fusion protein binds to axonemes derived from pf28 (Figure ​(Figure7).7). Rebinding is not affected by the addition of 1 mM ATP. This result suggests that IC140 is capable of binding directly to the microtubule cargo and may be involved in anchoring the I1 complex to the doublet microtubule. The result also indicates that at least one IC140 domain, responsible for binding, is located within the C-terminal 53 kDa (see Perrone et al., 1998).

Open in a separate window

Figure 7

Selective binding of the C1 fusion protein of IC140 to axonemes lacking the I1 complex. Increasing amounts of purified fusion protein were mixed and incubated with isolated axonemes from either pf28pf30, lacking the I1 complex (lanes a–d), or pf28 (lanes e–h) (see MATERIALS AND METHODS). (A) Western blots using anti-IC140 serum, which reveals the 53-kDa fusion protein (double arrowhead) and IC140 (arrowhead) and using HRP secondary antibodies and developed with chemiluminescent reagents. (B) Duplicate gel stained with Commasie brilliant blue, confirming equal loads for each sample.

Structural Domains in IC140: IC140 Is a WD-Repeat Protein

The structural basis for the assembly and docking of dynein is not known. However, sequence and secondary structural predictions for the IC proteins have shown that each is a member of the WD-repeat family of proteins, implying functional homology among the ICs (Paschal et al., 1992; Ogawa et al., 1995; Wilkerson et al., 1995). WD-repeat proteins were originally defined based on a repeating module of approximately defined size that begins with a GH and ends with WD, or respective equivalent residues (van der Voorn and Ploegh, 1992; Neer et al., 1994). In each case the module repeats four to eight times, suggesting that multiple adjacent WD modules are required for protein stability and function. The structural predictions for WD-repeat proteins have been confirmed by the crystal structure of the β subunit of G protein (Wall et al., 1995; Lambright et al., 1996; Sondek et al., 1996). Crystallography reveals that G_β folds into a circular sevenfold β-sheet “propeller.” Each blade consists of four antiparallel β-strands. However, similar β-propeller structures have also been discovered from non-WD-repeat proteins consisting of repeated β-sheet structures (Faber et al., 1995; Neer and Smith, 1996), suggesting that the consensus expression for defining a WD-repeat protein is insufficient to identify the less conserved repeats predicted to have the similar β-sheet structure.

Based on a WD-repeat consensus sequence and homology among the ICs, Wilkerson et al., (1995) and Ogawa et al., (1995) clearly established that the ICs are WD-repeat proteins. However, many repeats vary considerably from the consensus expression (for example, A and C repeats of IC78; Figure ​Figure5A).5A). Therefore, to assign the WD repeats in IC140, we compared WD-repeat regions with the predicted β-sheet structure and the homologous regions of the ICs. We discovered that on this basis each dynein IC contains seven repeated structures, including newly identified C′ and E′ repeats. The C′ and E′ repeats are located in homologous positions among the ICs. Thus, repeating WD/β-sheet units at equivalent positions in different proteins are more similar to each other than to other repeating units within a protein (Figure ​(Figure5A).5A). For example, the C repeat is more similar to the C repeat between ICs than to other repeats in the same protein, suggesting each repeat serves a conserved function. The simplest model is that each dynein IC contains seven WD/β-sheet repeats, which are likely to be arranged in a sevenfold β-sheet propeller, similar to that described in G_β.

Another region of conserved structure is the predicted coiled coil present in the C termini of IC140 and IC69 (Figure ​(Figure5),5), suggesting a common role. For example, deletion of the C-terminal coiled coil in IC69 resulted in failure to rescue Oda6 (Mitchell, personal communication). We demonstrate here that the fusion protein containing the last five WD repeats and the coiled coil of IC140 specifically bound the axonemes missing I1, suggesting at least part of the targeting domain for I1 is located in the C-terminal region of IC140. Moreover, the N-terminal coiled coils of IC74 are critical for interaction between dynein and dynactin (Vaughan and Vallee, 1995; Burkhardt et al., 1997; Steffen et al., 1997). Because the sheets within the propeller are not necessarily accessible, one plausible region for anchoring could be the coiled coil and/or the loops and variable regions between the WD repeats. The structure outside the WD/β-sheet repeats is predicted to primarily form α-helices and turns. Thus, BLAST searches have identified homology between IC140 and filamentous proteins such as collagen, fibroin, and intermediate filament protein. There may be little significance to these homologies.

We are grateful to Drs. M. Porter and C. Perrone (University of Minnesota) for helpful suggestions and for our collaboration. We are also thankful to Drs. C. Wilkerson and G. Witman (Worcester Foundation/University of Massachusetts) and E. Smith and P. Lefebvre (University of Minnesota) for providing the cDNA and genomic libraries and advice for cloning. Drs. S. Myster and M. Porter (University of Minnesota) generously contributed the 1-α heavy-chain antiserum. Drs. D. Mitchell (State University New York), S. L’Hernault, L. Quarmby, and G. Benian (Emory University) contributed valuable suggestions. This work was supported by grants from the National Institute of General Medical Sciences, National Institutes of Health.