Sample collection and testing for Chlamydia trachomatis

This study was performed on routine diagnostic samples for genital CT infection. IDEIA chlamydia collection kit, S600730, was used for the collection of endocervical and urethral swabs from females and urethral swabs from males. Two swabs (endocervical and urethral) from every female were placed in a single tube and were treated as a single sample. A single urethral swab was analysed from each male patient. Both IDEIA and Amplicor PCR were performed on the same sample according to the manufacturers' protocols, DakoCytomation Ltd, Ely, UK and Roche Molecular Systems, Inc, CA, USA respectively. After completion of the diagnostic work, samples were anonymised, coded, and stored at −20°C for further quality assurance work. The Cambridge local research ethics committee approved this study.

DNA extraction

DNA for in‐house PCR was extracted from 200 μl of each sample using the MagNA Pure LC total nucleic acid isolation kit and MagNA Pure LC Robot according to the manufacturer's protocol (Roche Molecular Systems, Inc, CA, USA). DNA was concentrated during extraction and was eluted in 60 μl of elution buffer.

In‐house plasmid and MOMP nested PCR

Two in‐house nested PCR assays targeting cryptic plasmid (plasmid PCR) and omp1 gene (MOMP PCR) were performed on all samples. In all, 122 pools from 854 of 856 Amplicor PCR negative samples were prepared. The volume of a pool was 35 μl containing 5 μl of DNA from each of seven Amplicor PCR negative samples. The two remaining Amplicor PCR negative samples were processed separately. Individual in‐house plasmid and MOMP PCR assays were performed on all samples in a pool which gave a positive result and 144 Amplicor PCR positive samples.

Nested PCR

Two rounds of PCR were performed on each sample or pool of DNA in 50 μl volume. A volume of 5 μl of DNA from a single sample or 35 μl of DNA from each pool was used in the first round PCR. The reactions in the second round contained 2 μl of amplicons from the first round PCR. The amplification reactions also contained 200 μM of each of dNTP, 25 pmol of each primer, 4 mM MgCl₂, 5 μl of 10× PCR buffer and 1.5 units of Taq DNA polymerase recombinant (Invitrogen life technologies, Paisley, UK). DNA from CT LGV‐II, strain 434 (ATCC VR‐902B) was used as a positive control and nuclease free water was used as a negative control for amplification. Six molecules of 100 bases long synthetic DNA and 2.5 pmol of forward and reverse primers to amplify this DNA were also added in the reaction to identify inhibition of amplification. Tenfold serial dilutions of CT positive control DNA were used to investigate the sensitivity of MOMP and plasmid PCR assays. Samples and controls were denatured at 95°C for 3 minutes, followed by 30 cycles of amplification in the first round and 25 cycles in the second round in a PTC‐200 Peltier Thermal Cycler (Genetic Research Instrumentation Ltd, Essex, UK). Each cycle consisted of denaturation at 95°C for 30 seconds, annealing of primers at 50°C for 1 minute, and extension at 72°C for 1 minute followed by final extension at 72°C for 7 minutes. The sequence of primers and internal control are shown in table 1​1.. The size of amplicons was ascertained in reference to PCR Markers (Promega, Madison, USA) by gel electrophoresis using 3% agarose (NuSieve 3:1 Agarose, Bio Whittaker Molecular Applications, Rockland, ME, USA).

Table 1Primers for plasmid and MOMP PCR

	Sequence	Position*	Amplicon size (bps)
First round MOMP PCR
Outer forward primer	5′‐TTGTTTTCGACCGTGTTTTG‐3′	203
Outer reverse primer	5′‐AGCRTATTGGAAAGAAGCBCCTAA‐3′	657	455
Second round MOMP PCR
Inner forward primer	5′‐AAACWGATGTGAATAAAGARTT‐3′	223
Inner reverse primer	5′‐TCCCASARAGCTGCDCGAGC‐3′	617	395
First round plasmid PCR
Outer forward primer	5′‐TTGGCYGCTAGAAAAGGCGATT‐3′	7153
Outer reverse primer	5′‐TCCGGAACAYATGATGCGAAGT‐3′	7365	212
Second round plasmid PCR
Inner forward primer	5′‐AACCAAGGTCGATGTGATAG‐3′	7179
Inner reverse primer	5′‐TCAGATAATTGGCGATTCTT‐3′	7328	150
DNA sequence of internal control
5′‐GTGCTCACACCAGTTGCCGCGGAAAGTATGTGGAATGTTAACACACCCACACCACACCCACACACGTGTTGGATCAATTTCGAGATGCGAGCTGCCAAGC‐3′
Forward primer for internal control	5′‐GTGCTCACACCAGTTGCCGC‐3′
Reverse primer for internal control	5′‐GCTTGGCAGCTCGCATCTCG‐3′

Open in a separate window

*Positions of primers for MOMP and plasmid PCR are according accession no. AF202457 and X06707, respectively.

We thank DakoCytomation Ltd and Roche Molecular Systems, Inc for providing support for this study. The sponsors of the study had no role in the study design, data collection, data analysis, data interpretation, or writing of this paper.

HJ, CS, and CC participated in study planning and design; HJ, HS, and AA performed practical work and data analysis; HJ was the lead writer; and all authors provided revision and commented on the paper.