STAMs interact with COPII and ERES proteins

Prompted by their co-localizations with early exocytic proteins, we assessed directly the interactions of STAMs with these proteins. Anti-STAM1 antibodies were more effective than anti-STAM2 antibodies in preliminary immunoprecipitation studies (not shown), and thus co-immunoprecipitations of endogenous HeLa cell proteins were performed using anti-STAM1 antibodies. As shown in Figure 1B, The COPII protein Sec31A clearly co-precipitated with anti-STAM1 antibodies while, in control experiments, non-immune immunoglobulin G (IgG) did not precipitate Sec31A. Additionally, the COPI protein βCOP and Golgi proteins including GM130, GGA3, and AP1 were not co-precipitated by the anti-STAM1 antibody (Figure 1B), indicating a selective interaction of STAMs with the COPII complex.

To investigate further the STAM1-COPII interactions, we performed a series of GST-STAM1 pull-downs. GST-STAM1 and GST fusion proteins immobilized on glutathione-Sepharose were incubated with lysates of HeLa cells overexpressing CFP-Sec31A, Sec13-YFP, GFP-LAMP1, or εCOP-YFP. As a positive control, there was very robust pull down of the GFP-Hrs protein (Figure 1C). Of the other proteins examined, only Sec31A was specifically retained on immobilized GST-STAM1. At longer exposure times, a faint interaction was also identified with Sec13, which may be indirect. The negative controls εCOP and LAMP1 exhibited no interactions with GST-STAM1 even at prolonged exposure times (Figure 1C and not shown).

We next examined interactions of the STAM1 paralog STAM2 with CFP-Sec31A and Sec13-YFP overexpressed in HeLa cells. Lysates from HeLa cells transfected with CFP-Sec31A alone or else co-transfected with Myc-STAM2 were immunoprecipitated with anti-GFP antibodies and then immunoblotted with anti-Myc antibodies, revealing that STAM2 co-precipitates with Sec31A (Figure 1D). Similar experiments were carried out using Sec13-YFP, which also co-immunoprecipitated with Myc-STAM2 (Figure 1E), while there was no interaction between Myc-STAM2 and εCOP-YFP (Figure 1F). Thus, both STAM1 and STAM2 interact with the Sec13/Sec31A COPII cage.

To identify which domains of STAM2 are required for interaction with the COPII cage proteins Sec13 and Sec31, co-transfections as described above were carried out using various STAM2 domain-specific deletion constructs. Of all the domains co-expressed with Sec31A, only the C-terminal region of STAM2 co-precipitated with Sec31A (Figure 1G). We were unable to narrow down further the interaction domain within the C-terminal region of STAM2, as smaller STAM2 C-terminal fragments were unstable (not shown). Similar experiments were conducted to determine regions of STAM2 that interact with Sec13. In addition to an interaction with the STAM2 C-terminal region, as seen with Sec31A, Sec13 also interacted with the VHS-SH3 segment of STAM2. Interestingly, the VHS domain alone was not sufficient to co-precipitate either Sec13 or Sec31A (Figure 1G). Non-interacting portions of Myc-STAM2 also serve as additional negative controls for the interactions identified between STAM2 and both Sec13 and Sec31A.

STAM overexpression results in Golgi fragmentation

To establish the functional role of STAMs in the ER-to-Golgi pathway, we overexpressed either STAM1 or STAM2 and assessed the Golgi apparatus for any morphological changes. In many HeLa cells overexpressing STAM1 or STAM2, the Golgi apparatus as identified with GM130 and giantin staining was highly fragmented and dispersed throughout the cell, though this phenotype was most prominent in STAM2-expressing cells (Figure 2A, B). In fact, expression of a control vector resulted in fragmentation in only 7% of cells, possibly attributable to normal disruption of Golgi structure that occurs during mitosis, whereas overexpression of Myc-STAM1 caused the Golgi apparatus to fragment in 33% of cells (p=0.0012); a stronger phenotype was seen upon overexpression of Myc-STAM2 (74% of cells with fragmentation; p<0.001). These studies were repeated using markers for several other well-characterized Golgi-associated proteins (AP1, CIMPR and GGA3), with similar results (not shown). Interestingly, the VTC marker ERGIC-53 was redistributed to the ER in STAM2-overexpressing cells (Figure 2A). There was, however, no significant difference in LAMP1 distribution upon STAM2 overexpression (Figure 2A).

Open in a separate window

Figure 2

Overexpression of STAMs causes dispersion of the Golgi complex

A) Overexpression of Myc-STAM2 (left panels) in HeLa cells disperses the Golgi markers GM130 and giantin, and causes ERGIC-53 to be retained in the ER, but does not affect LAMP1 distribution (right panels). Golgi apparatus and VTCs exhibit normal, perinuclear localization patterns in untransfected cells. Arrows identify transfected cells. Bar, 10 μm. B) Quantification of Golgi fragmentation in cells overexpressing Myc-STAM1, Myc-STAM2, or empty vector (Control) (n=3; 100 cells per experiment; ±SD). *p=0.0012; **p<0.001. C) Electron microscopy images showing typical Golgi morphology in control cells (asterisk; top panel), but much smaller stacked Golgi complexes in STAM2-overexpressing cells (asterisk; bottom panel). Images are at the same magnification. Bar, 500 nm. D) Immunogold localization of GM130 in control cells (1a), with higher magnification of the boxed area in (1b). Immunogold localization of GM130 in STAM2-overexpressing cells (2a), with the boxed region enlarged in (2b). Bar, 500 nm.

We examined the fragmented Golgi apparatus in STAM2-overexpressing cells using electron microscopy. Most cells overexpressing STAM2 had no detectable Golgi stacks, in marked contrast to control cells. However, in the few STAM2-overexpressing cells with an identifiable Golgi complex, the Golgi comprised “mini stacks,” where the length of the complex was significantly shortened (Figure 2C). The distribution of GM130 was assessed using immunogold electron microscopy. In control cells, GM130 localized to the cis-Golgi (Figure 2D1). However, in cells overexpressing STAM2, gold particles mostly decorated membranes that likely represent tubules of smooth ER, since they are more elongated than mini-stacks and lack the characteristic stacked cisternae of the Golgi apparatus. Even so, we cannot completely exclude the possibility that they represent isolated cisternae of an atypical Golgi mini stack (Figure 2D2).

STAM2 domains responsible for targeting and Golgi fragmentation

To identify domains of STAM2 that are involved in its localization to early exocytic membranes and maintenance of Golgi morphology, we expressed deletion constructs comprising various STAM2 domains in HeLa cells, then depleted cytosolic proteins with saponin prior to fixation. The full-length STAM2 expression pattern resembled an ER-like lattice intertwined with fragmented Golgi; this was most evident in regions where the Golgi appeared less fragmented, as assessed using GM130 (Figure 3A).

Open in a separate window

Figure 3

Effects of STAM2 deletions on subcellular distribution and Golgi fragmentation

A) HeLa cells transfected with full-length Myc-STAM2, HA-STAM2^VHS, or HA-STAM2^{C Term} were treated with saponin to deplete cytosolic proteins and then co-stained for Myc- or HA-epitope and GM130 or, Sec61α. HeLa cells overexpressing full-length STAM2 or the C-terminal fragment display the lattice-like staining adjacent to GM130 puncta, with areas of juxtaposed staining indicated with arrows (upper panels). Colocalization of thhe Myc-STAM2 lattice-like staining with the ER protein Sec61α is shown in the middle panels. In cells expressing HA-tagged STAM2^VHS, the juxtapositioned pattern with GM130 is more evident. Boxed areas are enlarged in the insets. B) Schematic diagram of STAM2 deletion constructs. Amino acid numbers are indicated. C) HeLa cells were transfected with control vector, HA-STAM2^VHS, HA-STAM2^VHS-SH3, HA-STAM2^{C Term}, or full-length Myc-STAM2 (FL), co-stained with GM130 and either Myc- or HA-epitope antibodies, then assessed for Golgi fragmentation (100 cells per condition; n=3; ±SD). *p<0.01; **p<0.005; ***p<0.001.

To establish whether overexpressed STAM2 localized to ER, we co-stained for the endogenous ER protein Sec61α, which exhibited significant co-localization (Figure 3A). STAM2^VHS-SH3 and STAM2^{C Term} fragments had expression patterns similar to full-length STAM2 (Figure 4A, B, and not shown). However, when STAM2^VHS was overexpressed, punctate STAM2^VHS labeling was prominently juxtaposed to fragmented Golgi, consistent with co-localization of ERES and Golgi proteins (20). This co-distribution was most evident in cells with less dispersion of Golgi fragments (Figure 3A). Taken together, these results indicate that the VHS domain is sufficient to target STAM2 to a location, potentially representing ERES, adjacent to the Golgi remnants, but not for stabilization of the interaction (as shown by the co-immunoprecipitation results in Figure 1G). A likely explanation for this apparent discrepancy is that the VHS-SH3, C Terminal, and full-length constructs of STAM2 are able to interact with COPII proteins, thus acting as dominant-negatives and displacing COPII proteins from ERES. This would lead to decreased co-localization by immunofluorescence. Since the VHS domain does not act as a dominant-negative, its co-localization with COPII proteins is potentially much greater. In other words, STAMs may be recruited to ERES before Sec31A and Sec13, and while STAM2^VHS may interact with a protein already at ERES, the other STAM2 domains could be important for stabilizing interactions with Sec13/Sec31A.

Open in a separate window

Figure 4

STAM proteins colocalize with and redistribute COPII proteins

A) Full-length Myc-STAM2 and Sec13-YFP expressed in HeLa cells colocalize at multiple discrete puncta (arrows; upper panels). Sec13-YFP and HA-STAM2^VHS puncta also co-localize (arrows, middle panels), sometimes juxtaposed to Golgi fragments as revealed by GM130 staining (arrowheads). The boxed area is enlarged in the lower panels. B) Overexpression of Myc-STAM2 as revealed by staining for Myc-epitope in HeLa cells results in decreased intensity of punctate staining for the COPII proteins Sec31A and Sec24C, but overexpression of STAM2 only slightly alters the Sec16L staining pattern. C) Overexpression of Myc-STAM2 has no effect on mitochondrial morphology or apoptosis as assessed with cytochrome c (Cyto c) staining (arrow indicates transfected cell). Bars, 10 μm.

To identify effects of these isolated domains on Golgi fragmentation, they were overexpressed individually, and cells were co-stained with GM130. While STAM2^VHS overexpression caused considerable Golgi fragmentation in comparison to control cells (p=0.0024), the effect was not as large as that seen with full-length STAM2 (Figure 3C), STAM^VHS-SH3, or STAM2^{C Term}, indicating that other domains are functionally important. Thus, overexpression of the STAM2 deletion constructs that interact with COPII (Figure 1G) are able to function in a dominant-negative manner and disrupt the Golgi complex, but to a lesser degree.

STAM2 impacts COPII protein recruitment to ERES

Golgi architecture is highly influenced by the organization and activity of the ERES. To establish whether the fragmented Golgi resulting from overexpression of STAMs represents Golgi remnants retained at ERES, we investigated the co-localization of STAMs with COPII proteins and their relationship to GM130 puncta. HeLa cells were co-transfected with Myc-STAM2 and Sec13-YFP, one of the first proteins to appear at the site of the nascent Golgi to mediate vesicle budding and also a marker for ER exit sites (21). Unfortunately, a majority of co-transfected cells had cytoplasmic displacement of Sec13, with subsequent loss of protein following the saponin treatment used to diminish the intense cytosolic expression of STAMs (not shown). Co-expressing cells with lower STAM2 levels treated with saponin exhibited less protein displacement, and multiple STAM2-positive puncta co-localized with Sec13-YFP puncta (Figure 4A). However, this paradigm may have limited co-localization of STAM2 with some ERES. When STAM2^VHS was co-expressed with Sec13-YFP, co-localization was more apparent, most likely due to decreased dominant-negative effects of this STAM2 deletion construct. Additionally, some puncta were adjacent to Golgi fragments, as shown by GM130 co-staining (Figure 4A), consistent with localization of STAM2 to ERES.

We sought to determine the effects of STAMs on distributions of COPII and ERES proteins. Cells were transfected with full-length STAM2 and immunostained for endogenous Sec31A, Sec24, and Sec16L (Sec16 comprises both Sec16L and Sec16S isoforms). Cells over-expressing STAM2 exhibited decreased intensity of Sec31A puncta as well as cytoplasmic redistribution of Sec24, when compared to untransfected cells (Figure 4B). On the other hand, no significant differences were apparent in the Sec16L staining pattern (Figure 4B). Given these effects of STAM2 overexpression, we investigated whether STAM2 had effects on other cellular organelles to ensure that the Golgi fragmentation phenotype in STAM-overexpressing cells was not secondary to apoptosis induction. We assessed mitochondrial structure and initiation of the apoptotic pathway by staining for cytochrome c. All cells overexpressing STAM2 had a normal mitochondrial reticulum, without fragmentation or cytochrome c release (Figure 4C).

Depletion of STAMs causes Golgi condensation

To assess further the role of STAMs on Golgi morphology, we determined the effects of STAM depletion on the Golgi apparatus using siRNA oligonucleotides. While both STAM2-specific oligonucleotides tested significantly knocked down STAM2 expression, siRNA oligonucleotide #1 depleted protein levels the most at 72 h (Figure 5A, B) and thus was used for subsequent studies.

Golgi morphology was examined using GM130 immunostaining at 48 h (not shown) and 72 h after transfection with STAM2 siRNA (Figure 5C). In a majority of siRNA-transfected cells, the normal ribbon-like Golgi structure had collapsed into a highly condensed, ball-like structure. A similar effect was seen when examining the Golgi markers GGA3 and CIMPR, but there was no apparent change in cellular distributions of tubulin or actin (Figure S2). Our criteria for assessing Golgi condensation were strictly set as a diameter ≤5 μm in all three dimensions, and there was a substantial difference when STAM2 siRNA cells were compared to control cells (p=0.0084; Figure 5D). Similarly, prominent Golgi condensation was observed upon specific knockdown of STAM1 (Figure 6A–C). We attempted a double knock down (DKD) of both STAM1 and STAM2 using siRNA. Though we were able to achieve effective depletion of STAM2, only about 50% of STAM1 was depleted (Figure 6A). Other conditions that increased depletion of STAM1 concominantly increased cell death (not shown). Under STAM DKD conditions, an even greater degree of Golgi condensation was observed (Figure 6B, C).

Open in a separate window

Figure 6

Knock down and overexpression of STAM1 confirms some functional redundancy with STAM2

A) Left panel, Extracts from HeLa cells transfected with any of three siRNA oligonucleotides specific for STAM1 or else with control siRNA were immunoblotted at 72 h post-transfection. Levels of STAM2 were unaltered. Right panel, Extracts from HeLa cells transfected with control siRNA or cotransfected with siRNAs for both STAM1 and STAM2 (STAM DKD) were immunoblotted with the indicated antibodies. Equal protein loading was monitored using PLCγ. B) HeLa cells were transfected with STAM1 siRNA or co-transfected with siRNAs for STAM1 and STAM2 (STAM double knock down [DKD]) or else with control siRNA. Percentages of cells with Golgi condensation (≤5 μm diameter in all dimensions) in STAM1 siRNA, STAM DKD, and control siRNA groups (n=3; 100 cells per experiment) are presented graphically (±SD). *p=0.0042; **p<0.0001. C) HeLa cells transfected with control, STAM1, or STAM DKD siRNAs were immunostained with anti-GM130 antibodies. As observed for STAM2 siRNA knock down cells, STAM1 siRNA cells also have a highly condensed Golgi apparatus. Bar, 10 μm. D) Re-transfection of HeLa cells with Myc-STAM1 after transfection with STAM2 siRNA suppressed the condensed Golgi phenotype (arrow). Bar, 10 μm.

Importantly, upon depletion of STAM2 we also noted an overall decrease in cell size. To determine whether the Golgi appeared condensed simply as a result of decreased cell size, we compared the ratio of Golgi size to cell size between the control and STAM2 siRNA groups. A significant difference was noted between the two groups, indicating that the Golgi size had decreased to a greater extent than cell size (p= 0.02; Figure 5E). Morphological changes in the Golgi complex were further assessed ultrastructurally using electron microscopy (Figure 5F). When comparing control and STAM2 siRNA cells at the same magnification in equivalent fields, we found that under control conditions an average of 1.8 Golgi stacks were clearly visible as compared to 5.9 stacks present in STAM2 siRNA cells (Figure 5F; n=25 cells per condition), demonstrating that the Golgi complex is condensed into a smaller area with retention of its cisternal organization.

STAM2 siRNA phenotype is rescued by STAM overexpression

Given the marked morphological changes in the Golgi apparatus upon STAM siRNA treatment, we sought to confirm that these effects could be reversed. We created a Myc-tagged form of STAM2 (STAM2′) with two silent point mutations in the region of STAM2 siRNA #1, rendering it siRNA-resistant without altering the primary amino acid sequence. We compared STAM2 levels in control siRNA cells, STAM2 siRNA cells, and STAM2 siRNA cells overexpressing Myc-STAM2′. There was a marked reduction of endogenous STAM2 protein in the STAM2 siRNA cells as compared to controls, and a significant increase in STAM2 levels in the STAM2 siRNA plus Myc-STAM2′ cells. This observed increase was due to production of the Myc-STAM2′ protein, as confirmed by immunoblotting with anti-Myc antibodies (Figure S3A).

Subsequently, we performed immunocytochemical analysis to detect any suppression of the loss-of-function, condensed Golgi phenotype seen in STAM2 siRNA cells. Cells overexpressing STAM2′ had an extensively fragmented Golgi apparatus, as expected (Figure S3B, C). In addition, the highly-condensed Golgi phenotype in STAM2 siRNA cells was suppressed by STAM2′ overexpression. In STAM2 siRNA-transfected cells with a relatively low expression of STAM2′, the Golgi was normal in appearance, while higher STAM2′ levels resulted in reversal of the condensed Golgi phenotype to one of fragmentation, consistent with a dose-dependent effect (Figure S3B). Lastly, STAM1 overexpression in STAM2 siRNA cells also suppressed the condensed Golgi morphology phenotype (Figure 6D), consistent with some functional redundancy between the STAMs.

Given the known role of STAMs in cytokine and growth factor signaling, we asked whether changes in Golgi and ERES distribution correlated with the tyrosine phosphorylation state of STAMs. We stimulated serum-starved HeLa cells with 100 ng EGF, and fixed them at 0–30 min [(22) and Figure S4]. Since peak tyrosine phosphorylation occurred at ~10 min (Figure S4A), consistent with previous reports (3), we immunostained cells just before, and 10 min after, EGF stimulation for GM130, Sec16L, or Sec31A (Figure S4B). There were no differences in GM130, Sec16L, or Sec31A staining patterns upon EGF stimulation, suggesting that the effects of STAMs on ERES are independent of their tyrosine phosphorylation state.

Loss of STAM2 inhibits Golgi recovery after brefeldin A treatment

To dissect the role of STAMs in regulating Golgi morphology, we used BFA, a drug commonly used to block transport of secretory cargo from the ER to Golgi by inhibiting the Arf1 GTPase. In BFA-treated HeLa cells, endogenous STAM2 remained adjacent to the Golgi marker GM130 even after Golgi membrane dispersal, and STAM2 puncta co-localized with the COPII protein Sec31A (Figure 7A). Thus, this co-localization is independent of Arf1 activity and, consequently, recruitment of STAM2 to this perinuclear region occurs upstream of Arf1 activity, suggesting that STAMs are targeted to ERES.

Open in a separate window

Figure 7

Localization of STAM2 to ERES in BFA-treated cells and delayed recovery of Golgi morphology in STAM2 siRNA cells following BFA

A) HeLa cells were treated with BFA and co-stained for STAM2 (green) and GM130 or Sec31A (red). STAM2 puncta are adjacent to GM130 puncta, and STAM2 puncta colocalize with Sec31A puncta. B) HeLa cells transfected with control or STAM2 siRNAs were treated with BFA and assessed after wash-out. Most control cells (upper panels) display normal Golgi morphology as assessed by GM130 staining after 1 h of recovery, whereas most STAM2 siRNA-treated cells (lower panels) have not recovered even after 3 h. Bar, 10 μm. C) Graphical presentation of the percentage of cells with Golgi reconstitution (lacking tubular Golgi) after transfection with STAM2 siRNA and control siRNA (n=3; 100 cells per experiment; ±SD).

We investigated whether loss of STAM2 altered the cellular response to BFA and whether STAM2 was necessary for reconstitution of the Golgi, as assessed by GM130 staining, after BFA wash out. Upon BFA treatment of control and STAM2 siRNA cells, no significant differences in disruption of the Golgi could be detected (not shown). Unexpectedly, once cells were returned to growth media after BFA treatment, STAM2-depleted cells exhibited a substantial impairment in Golgi reconstitution as compared to control cells. While almost all control siRNA cells showed full recovery of normal Golgi morphology 1 h after wash out, a majority of STAM2 siRNA cells still had severely disrupted Golgi membranes even after 3 h (Figure 7B, C), with many comprising punctate structures with tubular networks en route to the microtubule-organizing center (MTOC). Taken together, these results suggest that STAM2 is involved in reassembly of the Golgi apparatus after disruption with BFA and is important in efficient trafficking of Golgi proteins from the ER to the Golgi complex.

VSVG trafficking is impaired in STAM2-depleted cells

To assess whether STAM2 knock down impairs trafficking through the Golgi apparatus, we used VSVG ts045 as a reporter. Two days after transfection of HeLa cells with either control or STAM2 siRNA, both cell groups were re-transfected with VSVG-GFP and placed overnight at a temperature (40 °C) non-permissive for VSVG exiting the ER. Cells were then moved to a permissive temperature (32 °C) and examined at several time points. STAM2 siRNA-treated cells showed a substantial impairment in the ability of VSVG to traffic to the plasma membrane (Figure 8A). In control cells, VSVG was observed at the plasma membrane as early as 60 min after temperature change. However, at as late as 180 min the majority of the VSVG was present at the Golgi in the STAM2 siRNA cells, with VSVG barely detectable at the plasma membrane (Figure 8A). These results suggest that the presence of STAM2 is critical for efficient trafficking in the VSVG secretory pathway.

Open in a separate window

Figure 8

VSVG trafficking is impaired in cells lacking or overexpressing STAM2

A) HeLa cells were transfected with control siRNA (top panels) or STAM2 siRNA (bottom panels), and then re-transfected with ts045 VSVG-GFP. VSVG trafficked to the plasma membrane as early as 60 min after moving to a permissive temperature in control cells, while trafficking to plasma membrane was substantially reduced in the STAM2 siRNA cells. B) HeLa cells were singly transfected with VSVG-GFP (top panels) or else co-transfected with Myc-STAM2 (bottom panels; Myc staining not shown), then assessed at different time points after moving to a temperature permissive for VSVG trafficking. VSVG is present at the plasma membrane in control cells as soon as 90 min after the temperature change, whereas it is retained within the fragmented Golgi of STAM2-overexpressing cells even at 180 min. C) VSVG and GM130 are present in the same fragmented Golgi compartments in HeLa cells overexpressing STAM2 180 min after temperature change. The enlarged image in the inset shows VSVG staining (green) adjacent to GM130 puncta (red). Bar, 10 μm.

Overexpression of STAM2 inhibits VSVG trafficking

We investigated whether VSVG trafficking was affected by the Golgi dispersal resulting from overexpression of STAMs. Cells were transfected with VSVG-GFP or else co-transfected with Myc-STAM2 and VSVG-GFP, and both groups were placed overnight at 40 °C, as described above, and then assessed at different time points after moving to a permissive temperature (Figure 8B). In control cells, VSVG could be seen at the plasma membrane as soon as 60 min after the temperature change, and in all cells at 180 min, consistent with previous reports (23). In HeLa cells overexpressing STAM2, however, VSVG was visualized within fragmented structures dispersed throughout the cell. Furthermore, VSVG appeared retained within these punctate structures even at 180 min, with little detectable localization at the plasma membrane.

To ensure that these punctate VSVG structures coincided with the dispersed Golgi fragments reported earlier, cells were co-stained with GM130 (Figure 8C). We observed that the fragmented Golgi structures seen upon overexpression of STAM2 were adjacent to VSVG, consistent with the proteins being retained at ERES. These findings suggest that not only does STAM2 overexpression disrupt Golgi morphology, but also that it markedly impairs trafficking from ER to Golgi.

Antibodies

Rabbit polyclonal antibodies were used against the following proteins: STAM1 and STAM2 (Calbiochem), Sec16L (Bethyl Laboratories), Sec24C (from Dr. D. Stephens), HA-epitope (Abcam), giantin (Abcam), and GFP (Invitrogen). Mouse monoclonal antibodies were used against the following proteins: GM130 (IgG₁, clone 35; BD Transduction Laboratories), Myc-epitope (IgG₁, clone 9E10; Santa Cruz Biotechnology), mannose-6-phosphate receptor (IgG_2a, clone 2G11; Abcam), γ-adaptin (AP-1; IgG_2b, clone 100/3; Sigma-Aldrich), GGA3 (IgG_2a, clone 40; BD Transduction Laboratories), tubulin (Ig_G1, clone DM1A; Sigma-Aldrich), ERGIC-53 (Ig_G1, clone G1/93; Axxora), PLCγ (Upstate Biotechnology), EEA1 (IgG₁, clone 14; BD Transduction Laboratories), Sec31A (IgG₁, clone 32; BD Transduction Laboratories), LAMP1 (IgG₁, clone H4A3; Southern Biotechnology Associates), cytochrome c (IgG₁, clone 6H2.B4; BD Biosciences Pharmingen), and phosphotyrosine (IgG_2b, clone 4G10; Upstate Biotechnology). Actin distribution was assessed using rhodamine phalloidin (Invitrogen). Goat polyclonal anti-Myc-epitope antibodies were from Bethyl Laboratories. The goat polyclonal anti-Sec61α antibody (G-20) was from Santa Cruz Biotechnology. Alexa Fluor secondary antibodies were from Invitrogen.

Cell culture and transfection

HeLa cells were maintained in Dulbecco’s MEM/10% fetal bovine serum, plated on coverslips, and transfected with 1 μg of plasmid DNA using Lipofectamine (Invitrogen). Twenty-four hours later, cells were washed in phosphate-buffered saline (PBS; pH 7.4) and fixed using 4% formaldehyde or methanol. Cells used for immunoblot analysis were washed with PBS and collected in 0.1% Triton X-100 in PBS. For saponin treatment, HeLa cells were treated the day following transfection with 0.05% saponin in 80 mM PIPES (pH 6.8)/5 mM EGTA/1 mM MgCl₂ for 4 min, washed in PBS, fixed in 4% formaldehyde, and then processed for immunocytochemical analysis.

For siRNA transfections, HeLa cells were plated at 50% confluency and transfected the next day with 100 nM siRNA oligonucleotides for 4 h using Oligofectamine (Invitrogen). Cells were scraped for immunoblot analysis or fixed for immunocytochemical analysis 48 or 72 h after transfection. STAM2-specific siRNA oligonucleotides tagged with Alexa 647 fluorophore (Qiagen) were targeted against the following cDNA sequences: #1, CTGCTCAAACTTCATATTTAA; and #2, ATGGTACTTGATCTACATTTA. The control siRNA was from Ambion. STAM1 siRNAs (Invitrogen) were as follows: #1, UAACUUGGUAUAUAAGGAAAGGGCC; #2, AUACAUGGAAUACAUCGGAUCUUCG; #3, UUAAUACGUUGCUUACUUCACUAGC. Sec31A siRNAs (Invitrogen) were as follows: #1, CCAUAGCAGGUGGACAAGAACUCUU; #2, GCUCAGCAAUUGGAUGCAACAUUUA; #3, CCAGGCCAAUAAGCUGGGUGUCUAA. Sec16L siRNAs (Invitrogen) were as follows: #1, GGGCGCAAAGUGAGCUGCCAGAUUU; #2, CCGUCCCAUUCUGACAGCCUCGCUU; #3, CCCUGCCUAGUUUCCAGGUGUUUAA.

Immunoprecipitation and immunoblotting

HeLa cells were scraped with 0.5% NP-40 in PBS, centrifuged (16,200 × g, 15 min) and incubated with anti-STAM1 antibodies or else control IgG (5 μg) for 2 h at 4 °C for endogenous immunoprecipitation studies. For co-precipitation of overexpressed proteins, anti-GFP antibodies (5 μg) were used. Protein A-Sepharose beads were then added for 1 h. Beads were washed four times with decreasing concentrations of NP-40 in PBS, with the final wash in PBS alone. Samples were subjected to SDS-PAGE, transferred to PVDF membrane (Millipore), and immunoblotted.

GST fusion protein pull-downs

GST and GST-STAM1 fusion proteins were prepared and purified using glutathione-Sepharose beads as described previously (38). HeLa cells were singly transfected as described previously, and cell lysates were incubated with either GST beads or with GST-STAM1 beads for 90 min at 4°C. Beads were again washed vigorously with binding buffer three times and finally once with PBS, then immunoblotted.

Confocal microscopy

Cells were imaged using a Zeiss LSM510 confocal microscope with a 63× 1.4 NA Plan-APOCHROMAT lens. Acquisition was performed using LSM 510 version 3.2 SP2 software (Carl Zeiss Microimaging). Data were processed using Adobe Photoshop 7.0 and Adobe Illustrator CS2 software. For quantification studies, at least 100 cells were counted per experimental group, and experiments were conducted at least three times unless otherwise indicated.

To determine the ratio of Golgi size to cell size, projected images of cells from either control or STAM2 siRNA groups were analyzed using MetaMorph software (Molecular Devices). Cells were analyzed individually to obtain the ratio of the Golgi circumference (as assessed by GM130 staining) to cell size (determined using differential interference contrast microscopy). One hundred cells were assessed from each group, with n=3 for a total of 300 cells per group.

Electron microscopy

For structural assessment of Golgi, HeLa cells were fixed for 1 h in 4% glutaraldehyde in 0.1M sodium cacodylate buffer. For GM130 immunogold staining, cells were fixed in 2% paraformaldehyde and 0.1% glutaraldehyde in PBS for 1 h. Cells were blocked and permeabilized in 5% goat serum and 0.1% saponin in PBS for 1 h then placed in blocking buffer with the primary antibody for 1 h. Subsequent preparation of cells for electron microscopy has been described previously (44).

BFA treatment and VSVG-GFP trafficking

HeLa cells plated on coverslips in 6-well plates were placed in growth media containing 5 μg/ml BFA (Epicentre) for 1 h, then washed 3 times with PBS and placed in growth media for recovery of Golgi structure, then fixed at various times points.

For VSVG-GFP trafficking studies, HeLa cells were transfected with the VSVG-GFP construct and placed at 40 °C. Sixteen hours after transfection, HeLa cells were moved to 32°C to permit VSVG trafficking from the ER, and then fixed and processed for immunocytochemical analysis 0–180 min after the temperature change.

We thank James Nagle and Deborah Kauffman (NINDS DNA Sequencing Facility) for DNA sequencing, Carolyn Smith for assistance with confocal microscopy, Jung-Hwa Tao-Cheng for assistance with electron microscopy, and Chuang-Rung Chang for helpful discussions. This work was supported by the Intramural Research Programs of the NINDS and NHLBI, National Institutes of Health.