RNA Extraction and Quantitative Real-time (qRT)-PCR

Total RNA from cultured cells was extracted by using the RNeasy mini kit (Qiagen) according to the manufacturer's instructions. cDNA was synthesized from 5 μg of total RNA with Superscript III first-strand synthesis system (Invitrogen). cDNA samples were subjected to qRT-PCR amplification using custom primers on an Bio-Rad MyIQ detection system (Bio-Rad) according to the protocol provided by the manufacturer. Quantitative RT-PCR custom primers are described in supplemental Table 1. 18 S RNA served as an internal standard.

TaqMan miR Assay for Mature miR Expression Analysis

To measure mature miR expression, total RNA, including mature miRs, was extracted from cultured cells by using the microRNeasy mini kit (Qiagen) according to the manufacturer's instructions. Primers specific for miRs and U6 (Applied Biosystems) were used, and each mature miR expression was quantified using TaqMan microRNA assays (Applied Biosystems) following the manufacturer's protocol. In brief, TaqMan microRNA assays include two steps; that is, stem-loop RT followed by real-time PCR. For each 15-μl RT reaction, 10 ng of purified total RNA, 1× RT primer, 1× RT buffer, 1 mm dNTPs, 0.2 units/μl RNase inhibitor, and 3.33 units/μl MultiScribe reverse transcriptase from the TaqMan microRNA reverse transcription kit were added and incubated for 30 min at 16 °C followed by 30 min of incubation at 42 °C. qRT-PCR was performed using a standard protocol on a Bio-Rad MyIQ System (Bio-Rad). All TaqMan microRNA assays were performed in triplicate. Total RNA input was normalized based on the cycle threshold values of the U6 assay as an endogenous control. The -fold change was calculated based on delta cycle threshold between endogenous U6 control and miR-10a.

Fluorescence-activated Cell Sorting Analysis

Fluorescence-activated cell sorting analysis was performed as previously reported (26). Briefly, cell pellets were fixed, permeabilized using a BD Biosciences cytofix/cytoperm^TM kit, and incubated overnight with anti-SMA antibody (Millipore). Mouse IgG_2a served as isotypic control (Dakocytomation), whereas rat vascular SMCs served as positive controls. Goat anti-mouse IgG Alexa Fluor 488 was used as the secondary antibody (Molecular Probes). Finally, fluorescence was analyzed using the FACSCalibur^TM system (BD Biosciences) following the user's guide.

Construction of Reporter Plasmids and Reporter Assays

To generate the miR-10a-luciferase reporter plasmid, an ~900-bp fragment (−868 to +110 bp) containing the NF-κB putative binding site was amplified from C57/B6L mouse genomic DNA and then cloned into KpnI and HindIII sites of the pGL4.10 [Luc2] vector (Promega). The following primers were used for cloning the miR-10a promoter: ggaggggtaccagaatcccattttggcca (forward primer) and ggaggaagcttgcggagtgtttatgtcaact (reverse primer). For the construction of the p65mut-miR-10a luciferase plasmid, the NF-κB binding site was mutated from the miR-10a- luciferase construct using QuikChange XL mutagenesis (Stratagene) following the manufacturer's instructions. Primers used were as follows, resulting in the mutation of the putative NF-κB element (capitalized is the partial mutated region from the predicted miR-10a promoter): NF-κB-mF (forward primer, cttcttctcaggttgtaaacggaattTTTAgtcattaaatatggg) and NF-κB-mR (reverse primer, cccatatttaatgacTAAAaattccgtttacaacctgagaagaag). A DNA fragment containing the HDAC4 3′-UTR sequence with a putative miR-10a binding site was cloned into the SacI and HindIII restriction sites of the pMIR-REPORT^TM vector (Promega) to generate the HDAC4–3′-UTR reporter plasmid. Primers used to amplify the DNA fragment containing the HDAC4 3′-UTR from cDNA were HDAC4-F (forward primer, atactcagaagggacatcaag) and HDAC4-F (reverse primer, ccaaggcggccagaagagc). Site-directed mutagenesis against the putative miR-10a binding site located in the HDAC4–3′-UTR was generated by standard PCR to generate the HDAC4-mut-3′-UTR reporter plasmid. Primers used for site-directed mutagenesis are as follows: HDAC4-mF (forward primer, ctgaatttggtggcatttacagCCGCgatgggaactgggtcaagc) and HDAC4-mR (reverse primer, gcttgacccagttcccatcGCGGctgtaaatgccaccaaattcag). The final sequences of all constructed plasmids were confirmed by DNA sequencing. Constructed plasmids (0.2 μg of plasmid/well of 24-well plates) together with Renilla luciferase control reporter vector (pRL-TK) were transfected into HEK 293 cells using Lipofectamine 2000 (Invitrogen) for 4 h. Luciferase activity was measured 48 h after transfection using the Dual-Luciferase assay kit (Promega) with a TD-20/20 luminometer (Turner Designs). Individual luciferase activity was normalized to the responding TK promoter-Renilla-luciferase activity.

Western Blot Analysis

Whole cell lysate samples were extracted from cells using the mammalian protein extraction reagent M-Per (Promega) supplemented with a protease inhibitor mixture (Roche Applied Science). Cytoplasmic and nuclear fractions were obtained using NE-PER nuclear and cytoplasmic extraction reagents (Pierce) following the manufacturer's instructions. Antibodies against p65 (Santa Cruz Biotechnology, 1:1000), SMA (Millipore, 1:3000), SM-myosin heavy chain (SMMHC, BTI, 1:2000), glyceraldehyde-3-phosphate dehydrogenase (Santa Cruz Biotechnology, 1:1000), lamin A/C (Santa Cruz Biotechnology, 1:1000), and HDAC4 (Abcam, 1:500) were used for testing individual protein expression. Immuno-activity and band density was visualized by the enhanced chemiluminescence detection system (Amersham Biosciences) or Odyssey system (LI-COR Biosciences, Lincoln, NE) according to the manufacturer's instructions.

Expression Plasmids, miR Inhibitors, and Transfection

A complex of plasmids or oligonucleotides was transfected using Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol. miR-10a inhibitor and inhibitor negative control were purchased from Dharmacon. These inhibitors are RNA oligonucleotides with novel secondary structure designed to inhibit the function of endogenous miR (27). HDAC4, p65, Sp1, and SMAD3 expression plasmids were purchased from Addgene. PathDetect NF-κB Cis-Reporter Plasmid was purchased from Stratagene (NF-κB binding site luciferase).

MicroRNA Target Prediction

Target genes for miR-10a were predicted using the free software PicTar and TargetScan 4.2 with the cutoff set at p values less than 0.05.

Chromatin Immunoprecipitation (ChIP) Assay

Mouse ESCs were treated with 10 μm RA. After 6 h, cellular proteins were cross-linked, and a ChIP assay was performed by using the EZ-ChIP assay kit (Millipore). The size of the sonicated DNA fragments used for immunoprecipitation was between 500 and 1000 bp in length as determined by ethidium bromide gel electrophoresis. Purified chromatin was immunoprecipitated using anti-p65 antibody (Santa Cruz Biotechnologies). Eluted DNA fragments were purified to serve as templates for the PCR amplification. The input fraction corresponded to 2% of the chromatin solution before immunoprecipitation. IgG control serves as the negative control to the p65 antibody. By using rVista software to analyze conserved regions on the pre-mmu-miR-10a promoter, we identified a potential NF-κB binding site, which is located in the −638 to −627-bp region upstream of the transcription start site. The primers used to amplify the area containing this NF-κB binding site are: forward primer (5′-gctgcaacttttatggttcc-3′) and reverse primer 5′-gggagaggtgtctgggtgtg-3′), resulting in a 225-bp fragment.

Inhibition of miR-10a Impairs SMC Differentiation from Mouse ESCs

To examine the potential role of miR-10a during RA-induced ESC/SMC differentiation, a miR-10a inhibitor was transfected into ESCs. After 24 h of the transfection, ESCs were treated with RA for 3, 6, and 8 days and subjected to analysis of SMC markers by qRT-PCR for mRNA levels and Western blots for protein levels. The miR-10a inhibitor effectively reduced the expression of miR-10a to less than 20% that of control cells transfected with an inhibitor negative control (supplemental Fig. S2A). Intriguingly, when mature miR-10a levels were repressed, SMC marker expression during RA-induced ESC/SMC differentiation dramatically declined (Fig. 1, A and B) and differentiation efficiency to SMCs reduced, as evidenced by a decreased percentage of SMA-positive cell population in the derived cells (61.73 ± 3.38% in miR-10a inhibitor group versus 87.45 ± 2.45% in miR negative control, p < 0.05, Fig. 1C). In addition, no effect on other cell lineage-specific marker expression was observed during miR-10a repression in the context of this ESC/SMC differentiation system by day 6 (supplemental Fig. S2B). Interestingly, miR-10a expression was also up-regulated upon the RA treatment in the A404-SMC differentiation system (supplemental Fig. S3A). Furthermore, blockage of miR-10a expression with miR-10a inhibitor impaired SMC differentiation in this A404 system, as evidenced by down-regulation of SMC-specific markers (supplemental Fig. S3, B and C). Taken together, these results suggest that miR-10a is important for the RA-induced SMC differentiation process, probably by targeting specific genes involved in the SMC phenotype.

Open in a separate window

FIGURE 1.

miR-10a regulates SMC differentiation from ESCs. A and B, miR-10a inhibitor represses SMC differentiation. 50 nm miR-10a inhibitor or negative control was transfected into ESCs. Twenty-four hours after transfection, the cells were treated with 10 μm RA for 6 days and harvested for analysis of SMC markers expression, including SMA and SM myosin heavy chain (SMMHC), as evidenced by qRT-PCR (A) and Western blotting (B). NC, negative control. *, p < 0.05. 18 S RNA and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as internal controls for qRT-PCR and Western blot, respectively. C, miR-10a inhibitor reduces SMC differentiation efficiency. Mouse ESCs were transfected with either miR-10a inhibitor or miR inhibitor negative control, treated with RA for 6 days, and subjected to fluorescence-activated cell sorting analysis. The proportion of SMA-positive cells is shown in the histograms, representing RA alone (left panel), RA + inhibitor negative control (central panel), and RA + miR-10a inhibitor (right panel). n = 4. Normal IgG2a served as the fluorescence-activated cell sorting analysis control. FITC, fluorescein isothiocyanate.

miR-10a Mediates SMC Differentiation through Targeting on HDAC4

To better understand the miR-10a-dependent molecular mechanism regulating SMC differentiation, we performed a bioinformatics search for targets that might mediate this effect. Remarkably, one of the targets consistently predicted by two different algorithms, TargetScan 4.0 (28) and PicTar (29), was HDAC4. The predicted hybridization site was to a seed sequence in the HDAC4 3′-UTR that is evolutionarily conserved among vertebrate species (supplemental Fig. S4A). This result suggests that miR-10a may act to suppress HDAC4 and its activity during SMC differentiation. Secondary structure analysis also showed a favorable minimum free energy (−29.1 kcal/mol) in the formation of the miR-10a; HDAC4 3′-UTR duplex stem-loop (supplemental Fig. S4B). Consistent with this prediction, our results uncovered an inverse relationship between miR-10a expression and HDAC4 protein levels (supplemental Fig. S4C) during ESC/SMC differentiation without a significant change of HDAC4 mRNA levels (supplemental Fig. S4D). Furthermore, down-regulation of HDAC4 protein level was rescued when mature miR-10a expression was blocked by miR-10a inhibitor in this ESC/SMC differentiation system (Fig. 2A), without changes to HDAC4 mRNA levels (data not shown). This result is consistent with the functional prediction that miR-10a binding to the HDAC4 3′-UTR would lead to HDAC4 translational repression.

Open in a separate window

FIGURE 2.

HDAC4 is a miR-10a target during SMC differentiation from ESCs. Mouse ESCs were transfected with miR-10a mimic or mimic negative control (NC) and treated with RA for 6 days. A, cells were harvested at day 6, and cell lysate was used for the Western blot with an anti-HDAC4 antibody, or an anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody was used as the internal control. Representative Western blots are shown. B, either wild type or mutant HDAC4–3′-UTR reporter constructs were cotransfected into HEK 293 cells together with miR-10a mimic or mimic negative control (NC), as indicated. Forty-eight hours after transfection, cells were lysed, and luciferase activity was determined. Individual luciferase activity was normalized to the responding TK promoter-Renilla-luciferase activity. Relative luciferase activities were expressed as the mean ± S.D. Data shown are representative samples from at least three independent experiments, each done in triplicate. *, p < 0.05. C, representative Western blots in mouse ESCs were transfected with HDAC4. Mouse ESCs were transfected with human HDAC4-FLAG and subsequently induced to differentiate into SMCs with RA. The derived cells were subject to Western blot analysis. The expression of SMC markers was detected in extracts from cells differentiated for 6 days. Glyceraldehyde-3-phosphate dehydrogenase served as the internal control for Western blot. The right panel shows the quantitative analysis of SMC specific markers from Western blots. *, p < 0.05. SMMHC, SM-myosin heavy chain.

We next tested whether HDAC4 was a target for repression by miR-10a by cloning a fragment of the HDAC4 3′-UTR, containing either wild type or a mutant (mut) miR-10a binding site, downstream from the firefly luciferase gene in the pMIR- Report^TM vector (supplemental Fig. S4A). Co-transfections of miR-10a mimic with the HDAC4–3′-UTR reporter resulted in the repression of luciferase activity when compared with the mimic negative control (p < 0.05) (Fig. 2B). On the other hand, the HDAC4-mut-3′-UTR reporter was not repressed by miR-10a mimic. Neither mutation of the putative miR-10a complementary seed sequence nor the miR mimic negative control repressed luciferase activity, indicating that the repression was specific for miR-10a binding.

Although HDAC4 has been shown to mediate platelet-derived growth factor-BB pro-proliferation of SMCs (30), the function of HDAC4 on ESC/SMC differentiation is unclear. To further explore the function of HDAC4 on SMC differentiation in this differentiation system, the down-regulated HDAC4 expression was rescued by transient transfection of a HDAC4 expression plasmid in mouse ESCs, and subsequently, transfected cells were induced to differentiate with RA. As shown in Fig. 2C and supplemental Fig. S5, A–C, the expression of SMC-specific markers, including SM myosin heavy chain and SMA on both mRNA and protein levels, were significantly reduced after HDAC4 overexpression. Taken together, these results indicate that miR-10a represses the expression of HDAC4 at the post-transcriptional level during ESC/SMC differentiation, thus preventing its HDAC4-antimyogenic effects.