Rrm3 is required for fork progression across TERs

We used 2D gels to visualize replication intermediates at TERs in wt and rrm3 cells (Figures 3 and S3, Table S4 and data not shown). The visualization of replication termination intermediates is hampered by their fast turnover and by fork velocity. We found that the best approach to visualize termination structures is the 2D gel technique coupled with psoralen-crosslinking treatment. This procedures maximizes the visualization of the intermediates resulting form the converging of the two forks while it selectively resolves fork-related cruciform intermediates (Lopes et al., 2003)(Lopes and Foiani, unpublished observation) which are unrelated to replication termination and might interfere with the visualization of termination structures. We focused on two classes of TERs, those with (21/71) Rrm3-dependent pause sites such as CENs and tRNA genes and those without (46/71) which correlate with the presence of Pol II clusters (Azvolinsky et al., 2009).

Open in a separate window

Figure 3

Rrm3 contributes to fork progression across TERs

(A-C) wt (sy2209) and rrm3Δ (cy6807) cells were pre-synchronized in G2 with Nocodazole and released in α-Factor. Cells were then released in S-phase at 23°C and samples collected at 40′. Genomic DNA was analyzed by 2D gels. Schematic representations of the different fork pausing and termination signals are shown. The red letters in panel b indicate double Y and Xs respectively. The red numbers indicate pausing sites (see text for details). Relative BrdU maps, restriction digestion strategy and 2D gels quantification are shown in Figure S3.

In wt cells, at TER704, two spots (1 and 2 in Figure 3A) appeared on the Y arc reflecting fork pausing at CEN7. We also observed a diffuse termination cone signal with a defined X-spot (3) likely reflecting delayed termination at CEN7. rrm3Δ cells exhibited an increase in the intensity of Y- and X-spots consistent with its role in facilitating replication across pause sites (Ivessa et al., 2003). We obtained analogous results in other CEN-associated TERs (TER402, 1504 and 1604) (data not shown).

TER603 contains a tRNA gene and wt cells accumulated a pausing signal on the Y arc (1 in Figure 3B) (Deshpande and Newlon, 1996) and termination intermediates (a). In rrm3Δ cells, the intensity of the Y spot increased and another pause signal appeared (2) because Rrm3 facilitates fork progression even at tRNA genes transcribed co-directionally with the fork (Ivessa et al., 2003). rrm3Δ cells also exhibited a transition of the termination intermediates from a double Y conformation (a) to an X conformation (b) (Figure 3B). Moreover, an asymmetric X-spot accumulated (3) due to termination at the tRNA site. We obtained analogous results with TER1102 and 1503 (data not shown).

The accumulation of X-shaped converging forks in rrm3Δ cells may result from slowing down of one of the two forks at a pause site, which is then more likely to become a termination site as the other converging fork approaches. However this does not rule out that Rrm3 might also directly assist fork fusion later at termination.

The majority of TERs, including TER102, contains a Pol II transcribed gene that slows down forks independently of Rrm3 (Azvolinsky et al., 2009). Fork pausing throughout highly transcribed RNA polymerase II genes is not confined to specific sites and occurs over the entire ORF regions (Azvolinsky et al., 2009; Bermejo et al., 2009), thus it does not always generate obvious discrete spots o the Y arc of the 2D gel. While wt cells accumulated at TER102 a cone signal due to random termination (Figure 3C) (Greenfeder and Newlon, 1992a), rrm3Δ mutants accumulated Xs. A possible interpretation, although not exclusive, is that these X-shaped molecules result from the impaired fusion of converging forks. Indeed, partially replicated double Y termination intermediates are progressively converted into fully replicated Xs and then into replicated linear molecules (Figure 3C). While in wt cells, the conversion of Xs into linear intermediates is likely very fast as X molecules do not accumulate, rrm3Δ cells might be delayed in this termination step since these unresolved termination structures accumulate and persist during S-phase. Similar results were seen for TER101, 202, 301, 502, 601, 902, 1002, 1005, 1303 and 1608 (data not shown).

X-shaped structures can also arise as a result of recombination (Liberi et al., 2005; Schwacha and Kleckner, 1994). We failed to observe a significant difference between the level of Xs at TERs in rrm3Δ and rrm3Δ rad51Δ mutants, thus suggesting that these X-structures did not arise from recombination (data not shown). Moreover the X-shaped structures were detected at TERs but not at TER-flanking regions (data not shown) further suggesting that they are related to termination events.

In conclusion we analyzed by 2D gel 20 TERs corresponding to the three classes of TER. In all of them termination intermediates were visualized, thus validating our genomic approaches. Moreover, in all 20 cases, termination signals were enhanced in the absence of Rrm3, even at those TERs that do not contain obvious Rrm3-dependent pausing elements.

Top2 is recruited at TERs and facilitates replication termination

Top1, Top2 and Top3 move with forks (Bermejo et al., 2007) (data not shown). Topoisomerases might approach TERs by traveling with the forks or associate with TERs before or after the arrival of converging forks. The presence of topoisomerases at TERs may not be confined to S-phase as, topological constrains could persist after S-phase (Fields-Berry and DePamphilis, 1989; Holm et al., 1985). We investigated by ChIP-chip the presence of Top2 and Top3 at TERs, both in S and in G2/M cells.

Cells were released from G1 in HU or nocodazole. No enrichment was observed for Top3 at TERs under both conditions (data not shown). Top2 clusters were observed in S-phase and G2/M but not in G1 (Bermejo et al., 2007). The majority of S-phase Top2 clusters are related to fork associated Top2 and S-phase transcribed genes (Bermejo et al., 2009). We found that Top2 associates with 51/71 TERs in HU (p=0,00047) and in 55/71 in nocodazole (p=0,0065) even at those TERs that do not contain transcription units (Figure 4A, Tables S4 and S5). We obtained similar results when S-phase cells were grown with a different carbon source (53/71, p=0,0000056) (Tables S4 and S5). We failed to visualize Top2 in 4/71 TERs. Hence, Top2 associates with the majority of TERs before fork arrival and persists in G2/M.

Open in a separate window

Figure 4

Top2 is required for efficient replication termination

The ChIP-chip data are described as in Figure 1. (A) BrdU-labeled forks are indicated in orange. Top2-10Flag (cy7315) cells were arrested in G1 with α-factor and released at 23°C in the presence of HU for 1 hour or in the presence of nocodazole for 3 hours. Samples were collected at the indicated time points and processed for ChIP-chip analysis. As a control we show the BrdU-maps (in orange) that correspond to forks that have experienced 1h in HU. Green histogram bars represent the Top2 clusters in HU (IP-Top2 HU) and the blue ones indicate the Top2 clusters in nocodazole (IP-Top2 N). Red bars indicate the TER zones. (B) wt (sy2201) and top2-1 (cy7421) cells were released from α-factor in YPD with BrdU and HU at 37°C for 1 hour. BrdU maps of wt cells experiencing HU treatment at 23°C is also shown. Red bars indicate the TER zones. List of TERs containing Top2 clusters are shown in table S4 and the relative statistical analysis in table S5.

We then investigated whether fork fusion at TERs was affected in top2 mutants. We analyzed the convergence of the BrdU-labeled forks in wt and top2 cells released from G1 into HU at the restrictive temperature for one hour. Only TERs within an inter-origin spacing of ≤20Kb could be considered for this analysis. While wt cells efficiently completed replication at TER102, 103, 201, 403, 404, 902, 1005, 1202, 1302, 1401 and 1604 (Figure 4B and data not shown), in top2 mutants the same TERs exhibited un-replicated regions with an approximate size of 1kb. Since in top2 mutants the timing of origin firing is not delayed compared to wt cells (Bermejo et al., 2007), this result suggests that the replication of the last 1kb at TERs is somewhat limiting in top2 cells, perhaps due to the topological constrains generated at the point where forks converge. In support of this conclusion, kinetics analysis showed that, within the same replicon, specifically the fork experiencing termination was delayed but not the other one (data not shown). This observation further confirms previous findings indicating that sister replication forks can be uncoupled (Doksani et al., 2009; Wang et al., 2008). Replication termination at TERs was delayed but not prevented in top2 mutants as the forks converged later on (data not shown).

In top2 mutants at the restrictive temperature the chromosomes remain entangled and undergo breakage during cell division as shown by Pulse Field Gel Electrophoresis (PFGE) (Figure 5A). Conversely, we failed to detect obvious differences between wt and top3 mutants. We then investigated in top2 cells by PFGE a 109 kb EagI fragment of CHR III that includes two TERs between ARS305 and ARS307. In wt cells the genomic fragment was fully replicated by one hour, while in top2 mutants, it remained in the wells even at 4 hours and later accumulated DNA breaks (Figure 5B). DNA breaks appearance correlated with the decrease of the signal in the wells. We note that in top2 mutants at 37°C the nocodazole block persists for no more than 3 hours (Figure S4A). Again we failed to visualize entangled chromosomes and DSBs formation in top3 mutant. To address whether at least a fraction of DNA breaks in top2 mutants may be related to abnormal termination, we deleted ARS305 and ARS306 to prevent fork fusion in the EagI fragment. DSB formation in top2-1 ars305Δ ars306Δ, compared to top2-1 mutants was reduced about 3 fold at the EagI fragment but not at other regions (Figure S4B and data not shown). The residual breaks are likely due to faulty coordination between replication and transcription (Bermejo et al., 2009) and/or to rare termination events perhaps resulting from firing of the dormant ARS302-303-320 origins cluster (Wang et al., 2001), although we failed to detect by 2D gel any obvious bubble structure under our conditions.

Open in a separate window

Figure 5

Top2 is required for chromosome resolution

(A-B) wt (cy7627), top2-1 (cy7671) and top3^Y356F (cy 7629) cells were arrested in G1 with α-Factor and released in S-phase in YP+ Gal at 37°C in the presence of Nocodazole. Genomic DNA was extracted in agarose plugs at the indicated time points. Yeast chromosomes were separated by PFGE and analyzed by Southern blotting with the TER302 probe. M indicates the chromosome marker. DSBs indicate double strand breaks. (B) Agarose plugs were digested with EagI. Schematic representation of the analyzed region is shown. (C) wt (cy7627), top2-1 (cy7671) and top3^Y356F (cy 7629) were released in S-phase at 37°C and different samples (30′-40′-50′) were pulled together to increase the chance to visualized the replication intermediates. 30 μg of DNA were digested with HindIII and PstI and analyzed by 2D gels using TER302 probes. FACS, PFGE and 2D gels are also shown in Figure S4.

We then analyzed the replication intermediates at TER302 in wt, top3 and top2 cells at the restrictive temperature (Figure 5C). wt cells exhibited Ys but no obvious termination structures, perhaps because of their fast turn over at 37°C. We note that termination structures can be seen in the same region in wt cells at 23°C (data not shown). top3 mutants exhibited 2D gel profiles similar to wt. Conversely, top2-1 mutants accumulated additional fully duplicated X-intermediates only at TERs (Figure 5C) but not at other genomic locations (Figure S4C). These structures likely represent X-shaped entangled precatenane derivatives resulting from aberrant termination (Bermejo et al., 2007). We obtained analogous results for TER704 and TER1504 (data not shown). We conclude that Top2 and not Top3 plays a major role in the resolution of S-phase chromosomes and that genetic defects affecting the resolution process correlate with DNA breaks formation.

Pulse Field Gel Electrophoresis (PFGE)

DNA plugs were prepared as described (Lengronne et al., 2001). Yeast chromosomes were separated by PFGE (Gene Navigator System, Amersham) and electrophoresis was performed for 15 h at 200V with 90s pulses, followed by 9 h with 125s pulses, in TBE 0.5× at 14°C. Plugs digestion was performed in according to New England BioLabs and previously described (Azvolinsky et al., 2006).

Psoralen-crosslinking, DNA extraction, 2D-gel technique

Genomic DNA extraction was performed according the “QIAGEN genomic DNA Handbook”. DNA psoralen-crosslinking and 2D-gel procedure were described (Doksani et al., 2009). Quantifications were done using ImageQuant 5.2 (Molecular Dynamics).

Probes are obtained by PCR using the following oligos: TER102: Fw TCTGCGCCAAGCAAAGATTC, Rv TTTCCTTGCGTCTGATTCGG. TER603: Fw GAATGCCCGAGCCCTAAAAA, Rv ATGTGAGCCATCTGGAAAGG. TER704: Fw TGTGCACATCTTGCCCATTA, Rv GCCTCTATCACTGCAAAGTG.

TER302: Fw GAAGGTTCAACATCAATTGATTGATTCTGCCGCCATGATC, Rv GCTTCCCTAGAACCTTCTTATGTTTTACATGCGCTGGGTA

ChIP-chip analysis

S.cerevisiae oligonucleotide microarrays were provided by Affymetrix (S.cerevisiae Tiling 1.0R, P/N 900645). BrdU and proteins ChIP-chip analyses were carried out as described (Bermejo et al., 2009). Pol2 (Polε) ChIP-chip analysis was performed as described (Azvolinsky et al., 2009).

Comparative Genome Hybridization (CGH)

Roche-Nimblegen 385K Yeast Whole Genome Tiling arrays were used to perform CGH analysis. Experimental processing was performed accordingly to Roche-Nimblegen protocol, data elaboration using the NimbleScan v2.4 software (Roche-Nimblegen) and the analysis using the embedded packages DNAcopy and segMNT.

We thank A. Verreault and E. Schwob for reagents, Ted Weinert for communicating unpublished results, D. Branzei, M. Lopes and Y. Doksani for suggestions and critical reading of the manuscript, and all members of our laboratories for discussions. We thank M. Cesaroni for TER sequence analysis, M. Saponaro for technical advice and F. Ciccarelli for suggestion on evolution analysis. Work in the M.F. laboratory is supported by grants from Italian Association for Cancer Research, Italian Foundation for Cancer Research, Telethon-Italy, European Community, Italian Ministry of Health. D.F. was supported by a AIRC fellowship. Work in KS's laboratory is supported by a grant of the Genome Network Project and Grant-in-Aid for Scientific Research (S) from the MEXT, Japan. YK is a GCOE research associate. Work in V.A.Z.'s laboratory is supported by NIH grant R37 029638.