Abstract

INTRODUCTION

It has become fairly obvious that hypertension is an escalating clinical and public health problem for both developed and developing countries. According to recent report, as of the year 2000, 972 million people were afflicted worldwide and this figure is believed to rise to more than 1.56 billion by the year 2025 ^1,2. Human essential hypertension enhances the risk of a variety of adverse sequelae, including stroke, heart failure, coronary heart disease and renal failure ³. Essential hypertension has been recognized as a complex, multifactorial, polygenic trait which involves multiple modulating genes and environmental factors. To all appearances, identifying genes involved in polygenic trait is much more difficult than monogenic trait. This is because of the weak relationship between allelic variation of individual loci and phenotypic expression of the trait.

Interestingly, with the advent of molecular genetics, substantial progress has been made in the last decade towards detection of genes involved in essential hypertension using two principal techniques: linkage analysis and exploration of candidate genes. Unfortunately, these traditional techniques are inevitably limited in that they normally allow researchers to study barely one or a few genes simultaneously. However, recent advances in molecular biology and technology have made it feasible to quantify the expression levels of thousands of genes simultaneously by utilizing the microarray technology.

Microarray technology is a robust high-throughput method use for efficient and accurate simultaneous expression measurement of thousands of genes ^{4, 5, 6, 7}. The use of microarray technology for gene expression profiling has been successful and increasingly popular particularly in genetics and cancer research.

There is an extensive body of clinical and experimental evidence that inflammatory processes are important participants in both the initiation and development of hypertension ⁸. An evidence to this report is the elevated levels of proinflammatory markers such as Tumor necrosis factor-α (TNF-α), Interleukin-6 (IL-6) and C-reactive protein observed in individuals with hypertensive ⁹. Blood leukocytes are the predominant cells that provide immunity, mediate stress and inflammation, and generate cytokines, chemokines and growth factors that exepend important pathological and physiological actions on peripheral tissues. In that event, dissecting peripheral blood cells gene expression patterns of individuals with hypertension could reflect the potential markers of the disease, including inflammatory response which is an important causal pathway leading to hypertension. Not to mention, because of its handiness in clinical settings and fascinating roles in immune and metabolism, and its direct contact with the diseased vascular wall, peripheral blood may be the most practicable tissue type for gene expression profiling. We hypothesize that analysis of gene expression profiles from peripheral blood cells would distinguish patients with hypertension from normotensives. The purpose of this novel project is to use peripheral blood cells as a surrogate tissue to distinguish patients with human essential hypertension from normotensives by gene expression profiling. Accordingly, it is hoped that understanding the genetic determinants of hypertension will contribute to improvements in prevention, diagnosis and treatment of this disorder.

MATERIALS AND METHODS

Quantitative Real-Time RT-PCR validation of microarray gene expression patterns

To confirm the microarray data, ten differentially expressed genes were chosen because of their different processes and perceived biological relevance to the disease. Six (CD36 molecule (thrombospondin receptor), solute carrier family4 anion exchanger member 1 (SLC4A1), neuroepithelial cell transforming 1 (NET1), sestrin 3 (SESN3), zinc finger protein 652 (ZNF652), peroxiredoxin 6 (PRDX6)) were selected for their higher expression and four (Huntingtin interacting protein 1(HIP1), folate receptor 3 (gamma) (FOLR3), endoplasmic reticulum aminopeptide 1(ERAP1), complement factor D (CFD)) for their lower expression. The primers set for the ten genes were designed using Primer3 (Table ​(Table1).1). Briefly, the synthesized cDNA were subjected to qPCR and amplifications performed with BioEasy SYBR Green I (Biotechs, China). Specificity of all individual amplification reactions was confirmed by melting curve analysis. Real-time expression values were calculated by using the relative standard curve method. Relative quantification method was chosen for each of the 10 genes in our study. Standard curves were generated for each mRNA by using 10-fold serial dilutions. All reactions were based on the following recommended protocol using 0.5µl of each primer and 1µl of template per reaction.

Table 1

Real-Time PCR Primers for validation of microarray data

Gene Symbol	RefSeq Transcript ID	Forward Primers	Reverse Primers	Product size ( bp)	Temp
CD36	NM_000072	5'ATGGATTAAACCCAAATGAAGA 3'	5'CCCAGTCTCATTAAGCCAAAG 3'	188	58
SLC4A1	NM_000342	5'GCTCCTATTTCCCTGGCAAG 3'	5'CCGAGAGTTTCTGGGTGTAGGT 3'	120	60
NET1	NM_001047160	5'TACAGTCATTTACCCTTCGTGG 3'	5'TTCACCTCGGGACATTTCAT 3'	200	60
SESN3	NM_144665	5'CAGGCAGCAACTTTGGGATT 3'	5'GACGCCTCTTCATCTTCCCT 3'	100	60
ZNF652	NM_001145365	5'CTGTGGAAAATCATTCAAACGC 3'	5'TTTCGTCACAGTTCTCGCATCTA3'	95	60
PRDX6	NM_004905	5'TCTATCCTCTACCCAGCTACCA 3'	5'TCCCCATCCTTCCAATCAA 3'	119	60
HIP1	NM_005338	5'CGGACTCAGACTGTCAGCATC 3'	5'TGGCAGAACTTCCAGCAGAG 3'	179	60
FOLR3	NM_000804	5'TGTATGGCCAGTGCAGTCCC 3'	5'GCAGGTGGGTTCCATCTTAC 3'	131	60
ERAP1	NM_001040458	5'ATGCCATTGGTGAAATCTGTG 3'	5'CCACTCTTGGTTATCTTGCTGA 3'	137	60
CFD	NM_001928	5'CTGCTACAGCTGTCGGAGAAG 3'	5'CGCGTGGTTGACTATGCC 3'	129	60

Open in a separate window

Essentially, reactions were accomplished for each sample for 45 cycles/95/2min denaturing step; 94/15 sec annealing/extension step and final extension step at 60/40 sec in the ABI PRISM 7500 Sequence Detection System (Applied Biosystems, USA). Data are reported as values normalized to the housekeeping gene GAPDH. One-Way ANOVA analysis was performed using SPSS (13.0) software. Significance difference between the means for each gene was evaluated using LSD or Tamhane's T2 test (significance levels at P < 0.05). All values are presented as means ± SEM.

RESULTS

Validation of microarray results by real-time quantitative RT- PCR analysis

Ten genes were selected for further analysis and validation of microarray results using quantitative RT-PCR. These include CD36, SLC4A1, NET1, SESN3, ZNF652 and PRDX6 (up-regulated) and HIP1, FOLR3, ERAP1 and CFD (down-regulated). The values were presented as means ± SEM (Table ​(Table2).2). SPSS analysis shows that the expression of CD36 (p., 0.000), SLC4A1 (p., 5.091e-005), NET1 (p., 3.56e-008), SESN3 (p., 1.181e-005), ZNF652 (p., 0.000), PRDX6 (p., 0.000) are up-regulated and HIP1 (p., 0.000), FOLR3 (p., 0.000), ERAP1 (p., 0.004) and CFD (p., 0.006) are down-regulated (Fig. ​(Fig.1).1). The real-time quantitative RT-PCR results were consistent with that of microarray.

Open in a separate window

Figure 1

Quantitative PCR measurements of gene expression of CD36, SLC4A1, NET1, SESN3, ZNF652, PRDX6, HIP1, FOLR3, ERAP1, and CFD from peripheral blood cells samples of patients with hypertension and normotensives. Significant levels at (p<0.05).

DISCUSSION

In this study, we have successfully used gene expression profiling in peripheral blood cells to identify differences in transcription profile of human essential hypertension compared with normotensives. We chose to profile the blood in hypertensive patients because it is a sample that reflects ongoing pathologic processes such as inflammation and structural abnormalities. And therefore, inflammatory-related genes were expected to be modulated in our experiment.

In regards to limitation of the study, our sample size is relatively small due to the significant costs involved in microarray experiment. In addition, the microarray technology has decreased sensitivity to detect low-abundance genes. In spite of these limitations, our study reveals novel features of human essential hypertension.

Firstly, we investigated differences in transcription profile of human essential hypertension compared with normotensives. We identified 31 up-regulated genes and 18 down-regulated genes with FC of ≥2 or≤0.5 and q-value ≤5 % in expression. These genes and GO categories identified as being differentially expressed in essential hypertension versus normotensives may be of significant biological interest. To the best of our knowledge, this is the first time several of these genes become candidates for further investigation in their role in hypertension. Through quantitative RT-PCR, we confirmed the expression of 10 (CD36, SLC4A1, NET1, SESN3, ZNF652, PRDX6, HIP1, FOLR3, ERAP1 and CFD) out of the 49 differentially expressed genes. ERAP1 was previously shown to be an important player in hypertension. ERAP1 functions in several biological networks such as regulation of blood pressure, angiogenesis and presentation of antigens to MHC class I ^{17, 18, 19} as well as immune and inflammatory responses ²⁰. A possible role of ERAP1 in blood pressure regulation may be through its inactivation of angiotensin II and/or generation of bradykinin ^{17, 20}.

CD36 is a scavenger receptor expressed in macrophages, endothelial cells, denditic cells and in tissues such as muscle, heart and fat ^{21, 22}. Increasing evidence underscores the potential role of CD36 in the pathogenesis of hypertension. One possibility is through the regulatory effect of endothelin-1 on CD36 which might alter the properties of vascular smooth muscle cells (VSMCs), thus leading to the development of hypertension and atherosclerosis ²³. Pravenec and Kurtz demonstrated that deficiency in renal expression of CD36 could promote increase in blood pressure ²⁴.

The human anion exchanger 1 (AEI or SLC4A1) gene is a 911-residue glycoprotein that encodes protein in erythrocytes and basolateral surface of the alpha-intercalated cell in the collecting duct of the kidney ^{25, 26}. Intriguingly, this gene is a possible candidate for essential hypertension as its encoded protein does not only function as chloride/bicarbonate exchanger but also in pathways that regulate blood pressure ²⁷. Besides, Kokubo et al. ²⁸ reported association of SLC4A1 with both blood pressure variation and hypertension. Association between ZNF652 gene and systolic or diastolic blood pressure and hypertension has been reported elsewhere ^{29, 30}, however, its mechanistic role(s) were not defined. NET1 and SESN3 have been suggested to be associated with genotoxic stress and /or oxidative stress ^{31, 32, 33}. Short while, oxidative stress has been implicated in the pathophysiology of hypertension ^{34, 35, 36}. It is believed that an imbalance in superoxide and nitric oxide generation may lead to vasodilation and subsequently hypertension (Figure ​(Figure33).

Open in a separate window

Figure 3

Interconnections between Genes and their relationship to Hypertension. NO, indicates nitric oxide; AA, arachidonic acid; ROS, reactive oxygen species; NFKB, nuclear factor-kappa B; NADPH, nicotinamide adenine dinucleotide phosphate.

An increase in production of ROS enhanced depletion of antioxidant (PRDX6) which may cause oxidant stress thereby leading to hypertension ³⁷. The PRDX6 gene has also been implicated as a candidate gene for atherosclerosis ³⁸. Seemingly, it has been proposed that HIP1 mutations lead to abnormal hematopoiesis ³⁹ and Park& Zambidis ⁴⁰ have suggested a role of rennin-angiotensin system (RAS) in hematopoiesis. The critical physiological roles of RAS in blood pressure regulation could be a possible link between HIP1 and hypertension. FOLR3 has a high affinity for folic acid and folic acid has been reported to reduce serum homocysteine levels as well as systolic and diastolic blood pressure, in addition to improving the integrity of vascular endothelium ^{41, 42}. In the study of Gomez-Ambrosi et al. ⁴³, FOLR3 was differentially expressed in human omental adipose tissue of obese individuals. The differential expression of this gene in both obese and hypertensive individuals demonstrate further evidence for a consistent link between adiposity and hypertension. CFD is an immune/inflammatory-related gene involved in complement and coagulation cascades. Its role in hypertension biology could be through its association with pathological angiogenesis. The excessive, insufficient or abnormal angiogenesis has been implicated in the pathogenesis of several cardiovascular diseases, including hypertension ^{44, 45}.

Other modulated genes in our experiment, though were not validated by quantitative RT-PCR but maybe associated with and/or play role in hypertension include ABCA1, ABCG1, ACP1, HLA-DPB1, and HLA-DRB3. ATP binding cassette transporters (ABCA1, ABCG1) are important cellular cholesterol transporters/receptor in regulating cholesterol efflux. The implication of these genes as candidate genes for hypertension has been substantially catalogued ^{46, 47}. ABCA1 mutations may increase the risks of both cardiovascular diseases and type 2 diabetes by reducing plasma high density lipoprotein ⁴⁸. However, their mechanistic roles in the pathogenesis of essential hypertension remain irresolute.

Acid phosphate 1, soluble (ACP1) has been found to be related to CAD and was differentially expressed in human omental adipose tissue of obese individuals ^{49, 43}. The up-regulation of ACP1 in our study reinforces the notion that hypertension is indeed a disorder of cardiovascular endocrinology and metabolism. Furthermore, our study shows that HLA-DPB1 and HLA-DRB3 may play important role in hypertension. Association of these genes with cardiovascular, metabolic and immune diseases has been reported ^{50, 51, 52}.

Table ​Table44 lists GO categories and specific number of genes with their respective categories that were differentially expressed in peripheral blood samples of patients with hypertension compared with normotensives. The “MHC class II receptor activity” and “immune response” are intriguing and may be associated with human essential hypertension.

Biological pathway analysis identified several related pathways. The overexpression of these immune-related pathways may show that hypertension may be associated with immune/inflammatory responses.

Secondly, we analyzed the levels of CRP in patients with hypertension by measuring CRP levels in participants included in the study. The levels of inflammatory marker, CRP were elevated in hypertensive patients than the normotensives (Table ​(Table2).2). This finding which shows that inflammation is associated with hypertension is in concordant with many other studies ^{53, 54}. Of note, inflammations in individuals with hypertension have been clearly established, however, its contributory roles to the etiology of hypertension is probably secondary to hypertension. Endothelial dysfunction and angiotensin type 1 might be hypercritical in the development of hypertension. Recently, several studies have focused on endothelium and angiotensin molecular networks in the pathogenesis of hypertension, proposing that inflammation is associated with endothelium damage and the RAS. However, these questions, “Does inflammation lead to hypertension or does hypertension induce inflammation?” necessitate further investigation.

Taken together, this study has demonstrated gene expression changes in peripheral blood cells that accurately distinguish patients with human essential hypertension from normotensives. We have also identified a number of novel genes, GO categories and biological pathways that may be associated with the pathobiology of human essential hypertension. Moreover, our study has shown that inflammation is associated with hypertension. It is anticipated that understanding the genetic background of essential hypertension will provide accurate and efficient strategies for prevention, diagnosis and control.

Acknowledgments

References