Notch signaling and Notch ligand are activated at hypoxic invasive front

To further evaluate the role of Notch signaling in breast tumor progression, we examined the expression of cleaved Notch1 in 61 human breast tumor samples by immunohistochemistry (IHC) using NICD (Notch intracellular domain)-specific antibody. As shown in Fig. 2A and B, we observed that NICD is strongly expressed in both the nucleus and cytosol in normal gland of breast tissue; however, it was gradually decreased during tumor progression. In ductal carcinoma in situ (DCIS), an early stage of breast cancer, the expression of NICD was slightly decreased although strong nuclear expression was still observed. On the other hand, overall NICD expression was significantly reduced inside poorly differentiated tumor. Our tissue array results indicate that the expression of NICD had no significant correlation with the status of ER, PR or Her2, although it was significantly correlated with the expression of Jagged 2 and metastasis status of the patients (Supplemental Fig. S2A–B). Interestingly, the expression of NICD was significantly up-regulated at the invasive front of the same tumors (Fig. 2C). This striking difference suggests the critical role of Notch signaling in invasion and metastatic tumor progression of breast cancer. Because activation of Notch signaling requires ligand interaction, we sought a possibility that Jagged2 expression, which is significantly correlated to patient survival as shown in Fig. 1, is also expressed at the invasive front. Indeed, we found that both NICD and Jagged2 are strongly expressed at the invasive front while they are drastically reduced inside the tumors (Fig. 2C), suggesting that Jagged2 is the major ligand to activate Notch signaling at the invasive front. To further verify this notion, we examined the expression of other Notch ligands (Jagged1, DLL1, DLL 3 and DLL4) using the consecutively sectioned slide for the same area of the tumor. We found that Jagged2 among all other Notch ligands was indeed most strongly expressed in the invasive front (Supplemental Fig. S2C). Because Notch signaling is often activated by hypoxia (Sahlgren et al., 2008) and the invasive front of tumor mass is known to be hypoxic (Horree et al., 2007), we tested our hypothesis that Jagged2 is up-regulated at the invasive front through hypoxic signaling by performing immunohistochemistry using antibodies for well established hypoxia markers, CA9 and Glut1, as well as NICD. As shown in Fig. 2D, we found that CA9 and Glu1 were strongly expressed at the invasive front and these markers coincided with the elevated expression of NICD. These results strongly suggest that the activated Notch signaling at the invasive front is caused by increased expression of Jagged2 which is mediated by local hypoxia.

Open in a separate window

Fig. 2

Expression of cleaved Notch1 (NICD), Jagged2 and hypoxia markers at invasive front of breast tumor tissue

(A) Representative photos of breast tumor specimens at various stages after IHC with anti-NICD antibody. (B) Staining intensity of NICD at different stages was quantified. (C) Representative photos of two consecutive sections stained with anti-NICD and anti-Jagged2 antibodies at invasive front and inside of tumor. (D) Representative photos of IHC using antibodies to NICD, CA9 and Glut1 at invasive front and inside of tumor.

Hypoxia up-regulates Jagged2 in breast cancer cells

To provide further evidence that Jagged2 is activated by hypoxia in vitro, we examined the effect of hypoxia on Jagged2 expression in two different breast cancer cell lines, MCF7 and MDA-MB 231(MDA231), under normoxia (21%O₂) and hypoxia (1%O₂). As shown in Fig. 3A, we found that mRNA and protein levels of Jagged2 were significantly elevated in both MCF7 and MDA231 cells under hypoxia. However, we found no significant induction of other Notch ligands (Jagged1, DLL1, 2, 3 and 4) in either MDA231 or MCF7 cells under hypoxic condition (Supplemental Fig. S3A–B). In addition, the results of Jagged2 reporter assay indicate that hypoxia can significantly up-regulate the promoter activity of Jagged2 (Fig. 3A). However, we found no significant HIF1α binding sequence on Jagged2 promoter region. Therefore, to further verify that Notch signaling is indeed activated under hypoxia upon up-regulation of Jagged2, we examined the Notch reporter activity, protein level of NICD as well as HIF1α expression in MCF7 cells under normoxia and hypoxia. We found that Notch signal is indeed significantly augmented, which was accompanied by up-regulation of HIF1α level (Fig. 3B). We also examined the expression of NICD in the MDA-MB231 cells by immunocytochemistry and found that NICD was strongly expressed in the clustered cells but much less so in a separated single cell under hypoxic condition (Fig. 3C). These results suggest that hypoxia-induced NICD activation requires Jagged2-Notch interaction through cell-cell contact rather than stabilization of preexisting Notch signaling.

Open in a separate window

Fig. 3

Hypoxia significantly augments the expression of Jagged2

(A) Breast cancer cell lines, MCF7 and MDA-MB231, were cultured in two sets of 24-well plates under normoxic (21%O₂) or hypoxic (1%O₂) conditions for 24 hrs. One set of cells (in triplicate) was collected, and RNA was prepared. The samples were then subjected to qRT-PCR using primers for the Jagged2 and β-actin genes. Another set of cells was collected, and the cell lysates were subjected to Western blot analysis using anti-Jagged2 and anti-tubulin antibodies (inserted fig). For Jagged2 reporter assay, MCF7 cells were transfected with the Jagged2 reporter plasmid and they were incubated under normoxia or hypoxia. Luciferase activity was measured after 24hrs incubation. (B) MCF7 cells were transfected with Notch reporter plasmid (4XCBF-Luc) and they were incubated under normoxia or hypoxia for 24 hrs followed by luciferase activity assay. Western blot was performed to measure the protein level of NICD and HIF1α in MCF7 cells under normoxia or hypoxia (inserted figure). (C) MDA-MB231 were cultured under 1%O₂ and NICD immunocytochemistry was performed. Values are means ± SD of triplicate measurements. *, P<0.01.

Hypoxia-induced cell survival and EMT require Notch signaling

How the up-regulation of Jagged2 by hypoxia and concomitant activation of Notch signaling affect tumor progression is the next important question. Rapidly growing tumor cells at the invasive front must survive under hypoxic condition and need to be invasive; therefore, we speculated that hypoxia-induced Jagged2 plays a role in this process. To test this possibility, Jagged2 expression in four different breast cancer cell lines were examined by RT-PCR and Western blot (Fig. 4A), and we found that Jagged2 expression was significantly up-regulated in highly metastatic cell line, MDA231LM, which is derived from MDA231 cells while it is significantly lower in non-tumorigenic MCF10A cells. These results suggest an increasing chance of Notch signaling being activated in MDA231LM cells due to the large amount of Jagged2 expression, and this property of MDA231LM cells may be the result of metastatic phenotype selection driven by hypoxia. Next, we examined the role of Notch signaling in promoting cell survival under hypoxia. MDA231, MDA231LM and MDA231 LM-DNMAML which constitutively expresses the dominant negative Mastermind to suppress Notch signaling, were cultured under hypoxia and cell viability was measured at different time points by MTT assay. We found that the cell viability of MDA231LM was not affected by hypoxia; however, MDA231 and MDA231LM-DNMAML cells showed decreased cell viability after 48hr exposure to hypoxia, indicating that hypoxia induced cell survival requires Notch signaling (Fig. 4B). To further investigate the role of Jagged2 in promoting cancer cell survival under hypoxia, we knocked down the Jagged2 expression in MDA231LM and also ectopically expressed Jagged2 in MDA231 by infecting these cells with sh-Jagged2 and pSin-EF2-Jagged2 lenti viruses, respectively. As shown in Fig4 C, the knock-down of Jagged2 significantly attenuated cell survival in MDA231LM and MDA231cells under hypoxia, while the ectopic expression of this gene significantly augmented cell survival. Because the activation of Akt signaling is known to be a key mediator of cell survival under hypoxia, and Akt was reported to be a potential target of Notch signaling in melanoma and lung cancer (Bedogni et al., 2008; Zhao et al., 2010; Eliasz et al., 2010), we evaluated the effect of Notch signaling on Akt by treating MDA231LM cells with DAPT, a γ-secretase inhibitor which prevents the release of activated Notch intracellular domain. We found that the amount of phospho-Akt-1 was strongly decreased by the DAPT treatment under hypoxia, while the total amount of Akt was not affected by the suppression of Notch signaling (Fig. 4D). These results suggest that Notch signaling promotes cell survival under hypoxia through the activation of Akt pathway. Furthermore, to examine whether Notch signaling is involved in hypoxia-induced invasion and EMT in breast cancer cells, we first measured the invasive ability of MDA231LM cells using Matrigel invasion chamber under hypoxia in the presence or absence of DAPT for 24hrs. We found that the DAPT treatment significantly decreased the number of invading cells, suggesting that inhibition of Notch signaling abrogates the invasive ability of cancer cells under hypoxia (Fig. 4E). To further understand the molecular basis of Notch mediated cell invasion, we examined mRNA level of the snail gene, which is known to be involved in EMT by decreasing E-cadherin expression, in MCF7, MDA231 and MDA231LM cells. As shown in Fig 4F, the snail gene was highly expressed in MDA231LM which is the most invasive among the tested cell lines with highest level of expression of Jagged2. Hypoxia also induced the morphological change of MDA231LM cells to become a more mesenchymal shape which was reversed by DAPT treatment (Fig. 4G). Next, we examined the level of E-cad mRNA in MDA231LM and MCF7 cells under normoxia and hypoxia in the presence or absence of DAPT. We found that E-cad mRNA was significantly down-regulated in both MCF7 and MDA231LM cells under hypoxia, and this hypoxia effect was significantly abrogated by DAPT (Fig. 4H). To further examine the role of Jagged2 in promoting snail expression through activating Notch signaling, we cultured MDA231LM cells under normoxia and hypoxia with or without the infection of sh-Jagged2 lentivirus followed by measuring the mRNA levels of snail as well as Hes1 which is a typical downstream target of Notch signaling. As shown in Fig 2I, we found that the knock-down of Jagged2 significantly decreases the expression of both Hes1 and snail mRNA. Taken together, our results strongly suggest that the activation of Notch signaling mediated by hypoxia-induced Jagged2 expression leads to cell survival via Akt activation and cell invasion via promotion of EMT.

Open in a separate window

Fig. 4

Notch signaling promotes hypoxia-induced cell survival and EMT

(A) mRNA and whole cell lysates were prepared from the non-tumorigenic cell line, MCF10A and three human breast cancer cell lines, MCF7, MDA231 and MDA231LM, and quantitative RT-PCR and Western blot were performed to evaluate the amount of Jagged2 expression. (B) MDA231, MDA231LM and MDA231LM-DNMAML were cultured in 96-well plates under hypoxic condition (1%O₂). Cell viability was measured at different time point by MTT assay. (C) MDA231 and MDA231LM cells were infected with sh-Jagged2 and pSin-Jagged2 lentivirus, respectively. Cells were also infected with control lentiviruses. These cells were incubated for 12 hours under normoxic condition and they were transferred to hypoxic condition (1%O₂). After 72 hrs, cell viability was measured by MTT assay. Knock-down and ectopic expression of Jagged2 were also examined by Western blot (inserted photos). (D) MDA231LM cells were also cultured in the presence or absence of DAPT under hypoxia for 48 hrs and the expression of phospho-Akt was examined by Western blot. (E) MDA231LM cells were seeded in Matrigel invasion chambers in the presence or absence of DAPT (20 µM) under hypoxia. After 24hrs incubation, the number of invading cells was counted. (F) mRNA were prepared from MCF7, MDA231 and MDA231LM, and qRT-PCR was performed to evaluate the snail expression.(G) MDA231LM cells were cultured in the presence or absence of DAPT under normoxia or hypoxia for 48 hrs and cell morphology was observed under microscope. (H) mRNA levels of E-cadherin expression were examined in MDA231LM (left panel) and MCF7 cells (right panel) that were cultured under normoxia or hypoxia with or without the treatment of DAPT (20 µm). (I) MDA231LM cells were infected with sh-Jagged2 or control lentivirus for 12hrs under normoxia, and they were transferred to hypoxic condition (1%O₂). After 48 hrs of incubation, mRNA levels of Hes1 and snail were measured by qRT-PCR. Values are means ± SD of triplicate measurements. *, P<0.01.

Hypoxia up-regulates Jagged2 in bone marrow stromal cells

Bone is the major metastatic site of breast cancer. Several lines of evidence indicate that bone marrow is generally hypoxic, suggesting that hypoxic pre-metastatic niche may contribute to the progression of bone metastasis in breast cancer. Therefore, to examine the role of Notch signaling in bone metastasis with hypoxic microenvironment, we evaluated Jagged2 expression in immortalized human bone marrow stromal cells HS5 under hypoxic condition. We found that mRNA and protein levels of Jagged2 were significantly elevated by either 1% O₂ culture or hypoxia-mimetic compound DFO treatment in a time dependent manner (Fig. 5A). In addition, we also performed immunocytochemical staining of HS5 and HS27cells for Jagged2 expression under hypoxia. We found that the Jagged2 protein was strongly expressed in both HS5 and HS27 cells after being exposed to hypoxia for 48hrs (Supplemental Fig. S4). Next, we used MDA231BoM cell line, which has a strong tendency to metastasize to bones to examine whether interaction between bone marrow stromal cells and cancer cells indeed activates Notch signaling under hypoxia. A plasmid containing the Notch reporter gene was stably cloned into MDA231BoM cells, and the Notch reporter activity was measured after 48hr of co-culture with HS5 under hypoxia or DFO treatment (Fig. 5B). We found that the Notch reporter activity was significantly up-regulated in both hypoxia and DFO treated groups, implying that hypoxic bone microenvironment plays a pivotal role in activating Notch signaling in cancer cells and that such activation is contributed by the increased amount of Notch ligands, particularly Jagged2.

Open in a separate window

Fig. 5

Hypoxia up regulates Jagged2 expression in bone marrow stromal cells

(A) Human bone marrow stromal cell line, HS5, was cultured in two sets of 24-well plates under normoxic (21%O₂) or hypoxic (1%O₂) conditions for up to 48hrs. One set of cells was collected and RNA was prepared. The samples were then subjected to qRT-PCR using primers for the Jagged2 and β-actin genes. Another set of cells was collected, and the cell lysates were subjected to Western blot analysis using anti-Jagged2 and anti-tubulin antibodies (inserted figure). Similar experiments were performed to examine the mRNA and protein levels of Jagged2 in HS5 after DFO treatment by qRT-PCR and Western blot (right panel). (B) MDA231BoM cells which stably expressed the Notch reporter gene were seeded on monolayer of HS5 cells followed by DFO (left panel) or hypoxia (right panel) treatment. Luciferase activity was measured after 48hrs of co-culture. Values are means ± SD of triplicate measurements. *, P<0.01.

Plasmids construction

PGL2pro-4XCBF Notch reporter was a kind gift from Dr. Hayward (Johns Hopkins University). NICD cDNA with a Myc-tag was provided by Dr. Bresnick (University of Wisconsin). The tetracycline-inducible system T-Rex (Invitrogen) was used to create a cell line with inducible NICD expression. First, the Myc-NICD cDNA was amplified by PCR and cloned into pcDNA5/TO (Invitrogen). The human breast cancer cell line MDA231BoM was transfected with pcDNA6/TR encoding the Tet repressor, and a stable cell line (MDA231BoM/Tet) was generated. Then, the pcDNA5/TO/Myc-NICD expression plasmid was stably transfected into the MDA231BoM/Tet cell, and the resultant clones were designated as MDA231BoM Tet-Myc-NICD. To generate the Jagged2 reporter plasmid, the promoter of Jagged2 (from +15 to −1,352 bp) was amplified by PCR and the product was cloned into the PGL3-basic plasmid. The resultant clones were designated as PGL3-Jagged2. pCDNA3-Jagged2-myc was a kind gift from Dr Sisodia (University of Chicago) and Jagged2 sequence was sub cloned into pSin-EF2-Pur vector between EcoRI and SpeI sites.

Western blot

Western blot analysis was performed as described previously using antibodies against cleaved Notch1 (1:200; Val1744; Cell Signaling Technology), Jagged2 (1:200; R&D Systems Inc.), α -tubulin (1:1,000 Cell Signaling Technology), HIF1α (1:200; BD Bioscience), phospho-Akt1 (1:500; Ser473; Cell Signaling Technology), and Akt1 (1:500; Cell Signaling Technology) (Furuta et al., 2008).

Quantitative real-time PCR

Total RNA was isolated from the cells and reverse transcribed. The cDNA was then amplified with a pair of forward and reverse primers for the following genes: Jagged1(5’-TCGCTGTATCTGTCCACCTG - 3’ and 5’-AGTCACTGGCACGGTTGTAG - 3’), Jagged2 (5’- CTCCTCATTCGGGGTGGTAT - 3’ and 5’- GTCGTCATCCCCTTCCAGT -3’), DLL1 (5’- CAGGGTTGCACATTTCTCC -3’ and 5’- GCACGGACCTCAAGTACTCC-3’), DLL3 (5’- CCTGCGCGCTGAATGTC-3’ and 5’- CATCGAAACCTGGAGAGAGG-3’), DLL4(5’-CACACACTGGACTATAATCTGG -3’ and 5’- ACACATTCGTTCCTCTCTTCTG-3’)and β-actin (5’-TGAGACCTTCAACACCCCAGCCATG-3’ and 5’-CGTAGATGGGCACAGTGTGGGTG-3’). PCR reactions were performed using DNA engine opticon 2 system (MJ Research) and the Maxima® SYBR Green qPCR Master Mix (Fermentas Life Science). The thermal cycling conditions composed of an initial denaturation step at 95°C for 5 min followed by 40 cycles of PCR using the following profile: 94 °C, 30 s; 58 °C, 30 s; and 72 °C, 30 s.

Reporter assay

PGL3-Jagged2 plasmid was transfected to breast cancer cell line MCF7 by using Lipofectamine 2000 (Invitrogen). After 48 h, the cells were collected and the luciferase activities were then measured by using Dual-Luciferase Reporter Assay System (Promega). The Renilla expression plasmid phRG-TK (Promega) was used as an internal control.

MTT cell viability assay

Cells were seeded in 96-well plates and cultured under hypoxia (1%O₂) for the indicated time, and the viability was assessed by MTT assay (Promega).

Immunohistochemistry

Human breast cancer specimens were obtained from surgical pathology archives of the Akita Red Cross Hospital and Iwate Medical School. Human breast cancer tissue array was purchased from Biomax (BR1503). The sections from paraffin-embedded tissue specimens were deparaffinized and antigens were retrieved by heating the slides in 10 mM sodium citrate (pH 6.0) at 85 °C for 30min. The slides were treated with 3% H₂O₂ and then incubated overnight at 4 °C with anti-NICD rabbit polyclonal antibody (1:500; Abcam 8387 lot#329981.), anti-Jagged1 rabbit polyclonal antibody (1:200; Cell Signaling Technology), anti-Jagged2 goat polyclonal antibody (1:200; R&D Systems, Inc.), anti-DLL1 mouse monoclonal antibody (1:100; R&D Systems, Inc.), anti-DLL3 goat polyclonal antibody (1:200; Santa Cruz Biotechnology), anti-DLL4 rabbit polyclonal antibody(1:200; Santa Cruz Biotechnology), anti-glut1 antibody (1:100; Santa Cruz Biotechnology) and anti-CA9 mouse monoclonal antibody (1:100; R&D Systems, Inc.). The sections were then incubated with secondary antibodies and visualized using Envision-plus kit (Dako Corp.) or ABC staining system (Santa Cruz Biotechnology). Results of the immunohistochemistry were judged based on the intensity of staining, comparing the tumor cells and the normal glands on the same slide. Grading of the NICD expression levels was done by two independent persons without prior knowledge of the patient data.

Cancer stem-like cells isolation

Magnetic activated cell sorting (MACS) method was used to isolate cancer stem-like cells. Briefly, 5×10⁷ cells were suspended in 1ml MACS buffer and treated with DNase for 10mins at 37 °C. Cells were then suspended in 100µl of MACS buffer and further incubated with biotin-conjugated anti-CD24, APC-conjugated anti-CD44 and biotin-conjugated anti-ESA antibodies followed by incubation with anti-biotin antibody and anti-APC antibodies at room temperature for 10 min. CD24⁻, CD44⁺ and ESA⁺ fractions were collected by serial passages through magnetic columns according to the manufacturer’s protocol.

Immunocytochemistry

Cells fixed with 70% ethanol were washed with PBS and blocked by 2%BSA for 1hr. Cells were then washed again with PBS and incubated with primary anti-NICD (Val1744; Cell Signaling Technology) and anti-Jagged2 (1:200; R&D Systems, Inc) antibodies overnight at 4 °C. Cells were further incubated with anti-rabbit IgG Alexa Fluor (R) 555molecular probe (Cell Signaling Technology) and anti-goat FITC (Invitrogen) for 1hr at room temperature. Fluorescence images were taken by a fluorescent microscope.

In vitro invasion assay

Cell invasion assay was performed as described previously using Matrigel invasion chamber (Beckton Dickinson, Bedford, MA) (Bandyopadhyay et al., 2006). The cells that invaded through the membrane were stained with tetrazolium dye and their numbers were counted under microscope.

FACS (Fluorescence-activated cell sorting)

10⁴ Cells were suspended in FACS buffer (PBS with 0.1% BSA and 0.1% Triton X100) followed by incubation with FITC conjugated anti-CD24, APC conjugated anti-CD44 and PE conjugated anti-ESA for 15mins at room temperature. Cells were then washed with PBS and re-suspended in PBS for FACS analysis. For NICD expression analysis, cells were incubated with anti-NICD antibody (1:200, Val1744; Cell Signaling Technology) for 15 min at room temperature followed by incubation with anti-rabbit IgG Alexa Fluor (R) 555molecular probe for 10 mins at room temperature. Cells were then suspended in PBS and subjected to FACS analysis.

This work was supported by NIH (R01CA124650, R01CA129000 to KW), the US Department of Defense (BC085424, BC085590 to KW) and Susan Komen Foundation (KG080477 to KW).