Inhibiting FAS by inhibitors or shFAS induces apoptosis in breast cancer cells

FAS inhibitors, cerulenin and orlistat, have been shown to induce apoptosis in vivo and in vitro, but their specific mechanism is still not well understood. Here, our recently developed apoptosis biosensor, GC3AI whose fluorescence was activated by caspase-3-like protease during apoptosis, was used to real-time monitor apoptosis [18]. Our results showed that cerulenin and orlistat induced concentration-dependent apoptosis in breast cancer MCF-7 and MDA-MB-231 cells (Figure ​(Figure2A2A and ​and2B).2B). These results were consistent with those obtained from annexin V-staining flow data (Figure ​(Figure2A2A).

Open in a separate window

Figure 2

Apoptosis induced by FAS inhibitors and shFAS

(A) Orlistat-induced apoptosis in MCF-7 and MDA-MB-231 cells. Apoptotic cells were quantified by Annexin V staining or green fluorescence from the apoptosis biosensor, GC3AI. The similar results upon two methods were obtained. (B) Cerulenin-induced apoptosis in MCF-7 and MDA-MB-231 cells. Apoptosis was detected by the apoptosis biosensor GC3AI. (C) Western blots for FAS knockdown in MCF-7 and MDA-MB-231 cells. (D and E) Apoptosis in MCF-7 and MDA-MB-231 cells induced by shFASs. (F) Western blots for Bcl-2 and Bcl-xL over-expression in MCF-7 cells. (G and H) Effects of over-expressed Bcl-2 and Bcl-xL on cerulenin- or orlistat-induced apoptosis in MCF-7 cells. 10 μM of cerulenin and 100 μg/ml of orlistat were used. (I) A model for FAS inhibition-induced mitochondria-dependent apoptosis. Error bar indicates ± SE (n = 3). *p < 0.05; **p < 0.01 (t-test).

To further interrogate the role of FAS inhibition in apoptosis, shRNAs were used to deplete FAS expression in breast cancer cell lines MCF7 and MDA-MB-231 (Figure ​(Figure2C).2C). FAS depletion by shFASs also induced significant apoptosis in both breast cancer cell lines in three days (Figure ​(Figure2D2D and ​and2E).2E). However, a fraction of shFAS cells survived FAS depletion-induced cell death and appeared to adapt to FAS knockdown, here referred to as the adapted shFAS cells. Analysis of these cells showed that the FAS protein level was still significantly suppressed although not as dramatically as that in the initial shFAS cells (Supplementary Figure 2A). Furthermore, we found that the adapted shFAS cells showed the similar proliferation rate but the reduced colony formation ability in the conditions of 2D and 3D cell culture, compared with the control cells (Supplementary Figure 2B–2D). These results suggest that serious inhibition of FAS could induce apoptosis while mildly inhibiting FAS also suppress the colony formation of breast cancer cells.

Over-expression of Bcl-2 and Bcl-xL (Figure ​(Figure2F),2F), anti-apoptotic mitochondrial proteins, significantly blocked cerulenin- and orlistat-induced apoptosis in MCF7 cells (Figure ​(Figure2G2G and ​and2H),2H), suggesting that FAS inhibition induces mitochondria-dependent apoptosis (Figure ​(Figure2I2I).

ROS generation is induced by FAS inhibition but it is not responsible for apoptosis

Previous reports suggested that FAS inhibition could induce ROS generation [19, 20]. Here, we also observed that cerulenin and orlistat led to concentration-dependent and time-dependent increase in ROS levels in both MCF-7 and MDA-MB-231 cell lines (Figure ​(Figure3A3A and ​and3B,3B, Supplementary Figure 3A).

Open in a separate window

Figure 3

ROS is induced by FAS inhibition but not responsible for apoptosis

(A and B) Cerulenin and orlistat induced ROS generation in MCF-7 and MDA-MB-231 cells. ROS levels were measured after cells were treated with FAS inhibitors as indicated for 2 h. (C and D) Effects of trolox, BHA and NAC on ROS generation in MCF7 and MDA-MB-231 cells induced by cerulenin and orlistat. ROS levels were measured after cells were treated with 10 μM of cerulenin or 100 μg/ml of orlistat in combination with 2 mM of trolox, 10 mM of NAC or 100 μM of BHA for 2 h. (E and F) Effects of trolox, BHA and NAC on apoptosis in MCF-7 and MDA-MB-231 cells induced by cerulenin and orlistat. Apoptosis was measured after cells were treated with 10 μM of cerulenin or 100 μg/ml of orlistat for 48 h. Error bar indicates ± SE (n = 3).*p < 0.05; **p < 0.01 (t-test).

Next we determined if inhibiting ROS prevented apoptosis induced by FAS inhibitors. N-acetylcysteine (NAC) [21], an aminothiol and synthetic precursor of intracellular glutathione, was used to inhibit ROS. The results showed that the high levels of ROS induced by cerulenin and orlistat were reduced by NAC treatment in both MCF7 and MDA-MB-231 cell lines (Figure ​(Figure3C3C and ​and3D).3D). Meanwhile, apoptosis induced by FAS inhibitors was also significantly reduced (Figure ​(Figure3E3E and ​and3F).3F). To further confirm these observations, another two strong ROS scavengers, butylated hydroxyanisole (BHA) and trolox, were used to wipe off ROS. Intriguingly, the results showed that both BHA and trolox significantly decreased the level of ROS in both MCF7 and MDA-MB-231 cells (Figure ​(Figure3C3C and ​and3D),3D), but failed to inhibit and actually exacerbated apoptosis induced by FAS inhibitors (Figure ​(Figure3E3E and ​and3F).3F). These paradoxical results on ROS suggest that ROS is likely not the real cause to induce FAS inhibition-mediated apoptosis.

General reagents

Reagents cerulenin, orlistat, DPI, BHA, trolox and NAC were all obtained from sigma. The NADP⁺/NADPH Quantitation Colorimetric Kit (K347-100) was used to detect the NADP⁺/NADPH ratio obtained from BioVision.

Cell culture

Breast cancer cell lines MCF-7 and MDA-MB-231 were obtained from ATCC (Rockville, MD, USA), and cells were cultured in DMEM supplemented with 10% FBS (Biological Industries, Israel) inside an incubator containing 5% CO₂ at 37°C.

Immunohistochemistry

FAS expression was detected by immuno histochemistry. Fifty clinical specimens of primary breast cancers and matching non-tumor tissues were analyzed for expression of FAS. The sections were incubated with FAS antibody (1:50 dilution) for overnight at 4°C, then incubated with PV6001 (Zhongshan Goldbridge Biotechnology CO., Ltd., Beijing, China) for 30 min at 37°C and stained with DAB for 1 to 2 min. A semi-quantitative method and blind scoring were utilized by pathologist. As described [30], the extent of expression score was assessed on a scale of 0 to 4 (no positive cells = 0, 1–25% = 1, 26%–50% = 2, 51–75% = 3, >50% = 3), and the intensity score was also measured on a scale of 0 to 3 (negative = 0, weak = 1, moderate = 2, strong = 3). Multiplication of the values for intensity and extent of expression provided a score for immunoreactivity. For statistical analysis, samples with scores of 0–4 were considered to be low expression, while scores of 5–12 were considered to be high expression.

Western immunoblotting

The lysis buffer (20 mM of Tris-HCl, pH 7.5, 150 mM of NaCl, 1 mM of EDTA, 1% Triton X-100, 2.5 mM of sodium pyrophosphate, 1 mM of β-glycer-ophosphate, 1 mM of sodium vanadate, 1 mg/mL of leupeptin, and 1 mM of phenylmethyl-sulfonylfluoride) was used to obtain total protein, whose concentration was measured by Bradford method. 20 μg of protein was separated on a 10% of SDS-PAGE gel and blotted onto a PVDF membrane. 5% of fat-free milk blocks the membrane, which was then incubated with primary antibody for 1h and secondary antibody for 1h at room temperature [31]. The antibodies used in this study as following: FAS (Santa Cruz, Cat#sc-48357), Bcl-2 (Abcam, Cat#ab692), Bcl-xL (Abcam, Cat#ab77571). β-Actin (Santa Cruz, Cat#sc-1616) was used as an internal control. The secondary antibodies for western blot were obtained from Li-Cor, and Li-Cor Odyssey image reader (Li-Cor, USA) was used to western detection.

Determination of apoptosis

For the apoptosis assay by FACS analysis, 25 × 10⁴ cells were seeded into each well of the 6-well plates. Apoptosis assays were carried out based on the instruction from the Annexin V Apoptosis Kit (BD Biosciences). Briefly, cells were collected and washed twice with binding buffer containing 10 mM of HEPES, pH 7.4, 140 mM of NaCl, 2.5 mM of CaCl₂, and then resuspended at a concentration of 1 × 10⁶ cells/ml in binding buffer. One hundred microliters of the cell suspension was mixed with 5 μl of Annexin V-FITC and 10 μl of propidium iodide (50 μg/ml stock) and incubated at room temperature for 15 min. Four hundred microliters of binding buffer was added to each assay after the incubation and apoptotic cells were determined using a FACScan (BD Biosciences). Total Annexin V-positive cells were used to determine the level of apoptosis.

For the apoptosis assay by GC3AI biosensor [18], cells expressing GC3AI were grown in twelve–well plates. After the desired treatments, cells were then rapidly imaged with an EVOS^® FL digital inverted fluorescence microscope with 10× objective lens. The filter sets for imaging were: GFP: Ex470/22, Em525/50; PI (RFP): Ex531/40, Em593/40. GFP-positive cells were counted as apoptosis. Five random areas in each well were imaged, and each area contained more than two hundreds of cells. Cell counting was performed with ImageJ software (1.47) by analyzing these pictures.

Intracellular ROS measurement

2′,7′-Dichlorodihydrofluorescein diacetate (H₂DCFDA) (Invitrogen) was used to measure intracellular ROS, which was oxidized to fluorescent 2′,7′-dichlorofluorescein (DCF) in the presence of ROS. Cells washing with PBS two times after treatment with reagents were incubated with 20 μM of H₂DCFDA at 37°C for 30 min. To remove excess probe, the cells were washed with PBS again, and the fluorescence intensity was excited at 495 nm and measured at 527 nm emission wavelengths. Fluorescence intensity was calculated with ImageJ software (1.47) by analyzing these pictures.

Lentivirus generation and infection

Human Bcl-xL and Bcl-2 cDNA and apoptosis biosensor GC3AI cDNA were subcloned into the lentiviral expressing vector pCDH-CMV-EF1-puro (System Biosciences). shRNAs against FAS, CCCTGAGATCCCAGCGCTGTT and CATGGAGCGTATCTGTGAGAA, and a scramble sequence CCTAAGGTTAAGTCGCCCTCG were subcloned into the pLKO.1 lentivirus expressing vector. Viral packaging was done according to the previously described protocol [29]. Briefly, expressing plasmid pCDH-2/Bcl-xL or pLKO.1-shFAS, pCMV-dR8.91 and pCMV-VSV-G were co-transfected into 293 T cells using the calcium phosphate method at 20:10:10 μg (for a 10-cm dish). The transfection medium containing calcium phosphate and plasmid mixture was replaced with fresh complete medium after incubation for 5 h. Media containing virus was collected 48 h after transfection and then concentrated using 20% sucrose buffer at 20,000 g for 4 h. The virus pellet was re-dissolved in the proper amount of complete growth medium and stocked at −80°C. Cancer cells were infected with the viruses at the titer of 100% infection in the presence of Polybrene (10 μg/ml) for 48 h, and were treated as desired.

Animal tumor model and treatment groups

2 × 10⁶ MDA-MB-231 cells were suspended in 100 μl of PBS and injected into the flank of 6 week-old nu/nu mice. When tumors volume reached around 50 mm³,the mice were randomly divided into four groups (n = 5 per group): (a) control (200 μl of PBS thrice weekly by intraperitoneal injection); (b) DPI (1 mg/kg once per day by intraperitoneal injection) [32]; (c) orlistat (orlistat was extracted from capsules, and prepared according to methods reported by HuiYen Chuang at el [33], 240 mg/kg once per day by intraperitoneal injection); (d) DPI and orlistat combination (240 mg/kg of orlistat once per day by intraperitoneal injection, and 1mg/kg of DPI once per day by intraperitoneal injection). Therapy was continued for 20 days, and tumor volumes were detected every four days. As described, tumor volumes were determined using the formula: volume (mm³) = a × b² × 0.5 (a is the long diameter and b is the short diameter) [34]. On day 20 after treatment, all mice were sacrificed, and tumors were weighted and photos. All of the data are represented as means ± SE.