Cloning a custom sgRNA library o TIMING 2 d

• 3

  PCR amplification of pooled oligo library. Throughout the sgRNA library cloning process, refer to the following table or the number of reactions recommended at each cloning step for a library size of 100,000 sgRNAs and scale the number of reactions according to the size of the custom sgRNA library:

  Steps	Cloning process	Number of reactions
  3–7	PCR amplification of pooled oligo library	12
  8–10	Restriction digest of plasmid backbone	16
  11–12	Gibson assembly	10 with sgRNA insert, 5 control
  13–17	Isopropanol precipitation	10 with sgRNA insert, 5 control

  Amplify the pooled oligo library from Step 2 using the Oligo-Fwd and Oligo-Rev primers (Table 2). Prepare a master mix using the reaction ratios outlined below:

  Component	Amount per reaction (μl)	Final concentration
  NEBNext High Fidelity PCR Master Mix, 2×	12.5	1×
  Pooled oligo library template from Step 2	1	0.04 ng μl−1
  Oligo-Fwd primer (Universal)	1.25	0.5 μM
  Oligo-Knockout-Rev or Oligo-Activation-Rev primer	1.25	0.5 μM
  UltraPure water	9
  Total	25

  Critical Step To minimize error in amplifying oligos, it is important to use a high-fidelity polymerase. Other high-fidelity polymerases, such as PfuUltra II (Agilent) or Kapa HiFi (Kapa Biosystems), may be used as a substitute.

• 4

  Aliquot the PCR master mix into 25 μl reactions and perform a PCR using the following cycling conditions:

  Cycle number	Denature	Anneal	Extend
  1	98 °C, 30 s
  2–21	98 °C, 10 s	63 °C, 10 s	72 °C, 15 s
  22			72 °C, 2 min

  Critical Step Limit the number of PCR cycles to 20 cycles during amplification to reduce potential biases introduced during amplification.

• 5

  After the reaction is complete, pool the PCR reactions and purify the PCR product using the QIAquick PCR purification kit according to the manufacturer’s directions. Quantify the product by NanoDrop.

• 6

  Run the PCR purified oligo library from Step 5 on a gel along with a 50bp ladder: cast a 2% (wt/vol) agarose gel in TBE buffer with SYBR Safe dye. Run half of the oligo library in the gel at 15 V cm⁻¹ for 45 min.

  Critical Step Run on a 2% (wt/vol) agarose gel for long enough to separate the target library (140bp) from a possible primer dimer of ~120bp. Under the optimized PCR conditions suggested above the presence of primer dimers should be minimal.

• 7

  Gel extract the purified PCR product using the QIAquick gel extraction kit according to the manufacturer’s directions and quantify the final product by NanoDrop.

• 8

  Restriction digest of plasmid backbone. Digest the desired library plasmid backbone with the restriction enzyme Esp3I (BsmBI) that cuts around the sgRNA target region. Refer to the master mix set up below for the reaction ratios:

  Component	Amount per reaction (μl)	Final concentration
  FastDigest Buffer, 10×	2	1×
  Library Plasmid Backbone	1	50 ng μl−1
  FastDigest Esp3I (BsmBI)	1
  FastAP Thermosensitive Alkaline Phosphatase	1
  DTT, 100 mM	0.2	1 mM
  UltraPure water	14.8
  Total	20

• 9

  Aliquot 20 μl reactions from the master mix and incubate the restriction digest reaction at 37 °C for 1 h.

• 10

  After the reaction has completed, pool the restriction digest reactions from Step 9 and run the entire pooled restriction digest reaction on a gel. Cast a 2% (wt/vol) agarose gel in TBE buffer with SYBR Safe dye and run the reaction in the gel at 15 V cm⁻¹ for 30 min. Gel extract the library plasmid backbone using the QIAquick gel extraction kit according to the manufacturer’s protocol and quantify by NanoDrop. Note that the Gecko library backbones contain a 1880bp filler sequence which should be visible as a dropout. The SAM library backbones do not contain a filler sequence and the expected dropout of 20bp is usually not readily visible.

• 11

  Gibson Assembly. Set up a master mix for the Gibson reactions on ice according to the reaction ratios below. Be sure to include reactions without the sgRNA library insert as a control.

  Component	Amount per reaction	Final concentration
  Gibson Assembly Master Mix, 2×	10 μl	1×
  Digested library Plasmid Backbone from Step 10	330 ng	16.5 ng μl−1
  SgRNA library insert from Step 7 or UltraPure water control	50 ng	2.5 ng μl−1
  UltraPure water	To 20 μl
  Total	20 μl

• 12

  Aliquot 20 μl reactions from the master mix and incubate the Gibson reaction at 50 °C for 1h.

  Pause Point Completed Gibson reactions can be stored at −20 °C for at least 1 week.

• 13

  Isopropanol precipitation. Pool cloning and control reactions separately. Purify and concentrate the sgRNA library by mixing the following:

  Component	Amount per reaction (μl)	Final concentration
  Gibson Assembly Reaction	20
  Isopropanol	20
  GlycoBlue Coprecipitant	0.2	0.075 μg μl−1
  NaCl solution, 5 M	0.4	50 mM
  Total	~40

  Critical Step In addition to concentrating the library, purification by isopropanol precipitation removes salts from the Gibson reaction that can interfere with electroporation.

• 14

  Vortex and incubate at room temperature for 15 min and centrifuge at >15,000 × g for 15 min to precipitate the plasmid DNA. The precipitated plasmid DNA should appear as a small light blue pellet at the bottom of the microcentrifuge tube.

• 15

  Aspirate the supernatant and gently wash the pellet twice without disturbing it using 1 ml of ice-cold (−20 °C) 80% (vol/vol) ethanol in UltraPure water.

• 16

  Carefully remove any residual ethanol and air dry for 1 min.

• 17

  Resuspend the plasmid DNA pellet in 5 μl of TE per Gibson reaction by incubating at 55 °C for 10 min and quantify the custom sgRNA library by NanoDrop. Isopropanol-purified sgRNA libraries can be stored at −20 °C for several months.

Amplification of pooled sgRNA library o TIMING 2 d

• 18

  Pooled sgRNA library transformation. Electroporate the library at 50–100 ng μl⁻¹ using Endura ElectroCompetent cells according to the manufacturer’s directions. If amplifying a ready-made genome-scale library from Addgene, repeat for a total of 1 electroporation per 10,000 sgRNAs in the library. If amplifying a custom sgRNA library, repeat for a total of 1 electroporation per 5,000 sgRNAs in the library and include an additional electroporation for the control Gibson reaction.

• 19

  Pre-warm 1 large LB agar plate (245 mm square bioassay dish, ampicillin) per electroporation of the sgRNA library at 37 °C. Each large LB agar plate can be substituted with 10 standard LB agar plates. Pre-warm 1 standard LB agar plate (100 mm Petri dish, ampicillin) for calculating electroporation efficiency at 37 °C. For amplification of a custom sgRNA library, include an additional standard LB agar plate for the control Gibson reaction.

• 20

  After the 1 h recovery period, pool electroporated cells and mix well by inverting.

• 21

  Prepare a dilution for calculating transformation efficiency. To prepare the dilution mix, add 10 μl of the pooled electroporated cells to 990 μl of LB medium for a 100-fold dilution and mix well. Then add 100 μl of the 100-fold dilution to 900 μl of LB medium for a 1,000-fold dilution and mix well.

• 22

  Plate 100 μl of the 1,000-fold dilution onto a pre-warmed standard LB agar plate (100 mm Petri dish, ampicillin from Step 19). This is a 10,000-fold dilution of the full transformation that will be used to estimate the transformation efficiency.

• 23

  If amplifying a custom sgRNA library, repeat Steps 21–22 for the control Gibson reaction.

• 24

  To plate pooled electroporated cells, add 1 volume of LB medium to the pooled electroporated cells from Step 20, mix well, and plate on large LB agar plates (option A) or standard LB agar plates (option B).

  1. Plating on large LB agar plates

     1. Plate 2 ml of electroporated cells on each of the pre-warmed large LB agar plates from Step 19 using a cell spreader. Spread the liquid culture until it is largely absorbed into the agar and does not drip when the plate is inverted. At the same time, make sure the liquid culture does not completely dry out as this will lead to poor survival.

  2. Plating on standard LB agar plates

     1. Alternatively, plate 200 μl of electroporated cells on each of the pre-warmed standard LB agar plates from Step 19 using the same technique as described in Step 24 Ai.

        Critical Step Plating the electroporated cells evenly is important for preventing intercolony competition that may skew the sgRNA library distribution.

• 25

  Incubate all LB agar plates overnight at 37 °C for 12–14 h.

  Critical Step Limiting the bacterial growth time to 12–14 h ensures that there is sufficient growth for sgRNA library amplification without potentially biasing the sgRNA library distribution through intercolony competition or differences in colony growth rates.

• 26

  Calculate electroporation efficiency. Count the number of colonies on the 10,000-fold dilution plate. Multiply the number of colonies by 10,000 and the number of electroporations to obtain the total number of colonies on all plates. If amplifying a ready-made sgRNA library from Addgene, proceed only if the total number of colonies is greater than 100 colonies per sgRNA in the library. If amplifying a custom sgRNA library, proceed only if there are more than 500 colonies per sgRNA in the library.

  Critical Step Obtaining a sufficient number of colonies per sgRNA is crucial for ensuring that the full library representation is preserved and that sgRNAs did not drop out during amplification.

  Troubleshooting

• 27

  In addition, for amplification of a custom sgRNA library, calculate the electroporation efficiency for the control Gibson reaction and proceed only if there are at least 20 times more colonies per electroporation in the sgRNA library condition compared to the control Gibson reaction.

  Troubleshooting

• 28

  Harvest colonies from the LB agar plates. Pipette 10 ml of LB medium onto each large LB agar plate or 1 ml of LB medium onto each standard LB agar plate. Gently scrape the colonies off with a cell spreader and transfer the liquid with scraped colonies into a 50-ml Falcon tube.

• 29

  For each LB agar plate, repeat Step 28 for a total of 2 LB medium washes to capture any remaining bacteria.

• 30

  Calculate the number of maxipreps needed by measuring the OD600 of the harvested bacterial suspension as follows: Number of maxipreps = OD600*(total volume of suspension)/1200. Maxiprep the amplified sgRNA library by using the Macherey-Nagel NucleoBond Xtra Maxi EF kit according to the manufacturer’s directions.

  Critical Step Using an endotoxin-free plasmid purification kit is important for avoiding endotoxicity in virus production and mammalian cell culture. To ensure that the plasmid preparation is endotoxin-free, it is important to dilute the bacterial suspension to an OD600 within the linear range of the spectrophotometer, typically around 0.1–0.5, and measure the OD600 of the dilution. Then multiply the OD600 by the dilution factor to obtain the OD600 of the bacterial suspension. Approximately 1 maxiprep is needed for 2 densely plated large LB agar plates.

• 31

  Pool the resulting plasmid DNA and quantify by NanoDrop. Maxiprepped sgRNA library can be aliquoted and stored at −20 °C.

Next-generation sequencing of the amplified sgRNA library to determine sgRNA distribution o TIMING 3–5 d

• 32

  Library PCR for NGS. We have provided NGS primers that amplify the sgRNA target region with Illumina adapter sequences (Table 3). To prepare the sgRNA library for NGS, set up a reaction for each of the 10 NGS-Lib-Fwd primers and 1 NGS-Lib-KO-Rev or NGS-Lib-SAM-Rev barcode primer as follows:

  Component	Amount per reaction (μl)	Final concentration
  NEBNext High Fidelity PCR Master Mix, 2×	25	1×
  Pooled sgRNA library template from Step 31	1	0.4 ng μl−1
  NGS-Lib-Fwd primer (unique)	1.25	0.25 μM
  NGS-Lib-KO-Rev or NGS-Lib-SAM-Rev primer (barcode)	1.25	0.25 μM
  UltraPure water	21.5
  Total	50

  Critical step Using a different reverse primer with a unique barcode for each library allows for pooling and sequencing of different libraries in a single NextSeq or HiSeq run. This is more efficient and cost-effective than running the same number of libraries on multiple Miseq runs.

  Critical Step To minimize error in amplifying sgRNAs, it is important to use a high-fidelity polymerase. Other high-fidelity polymerases, such as PfuUltra II (Agilent) or Kapa HiFi (Kapa Biosystems), may be used as a substitute.

• 33

  Perform a PCR using the following cycling conditions:

  Cycle number	Denature	Anneal	Extend
  1	95 °C, 5 min
  2–13	98 °C, 20 s	60 °C, 15 s	72 °C, 15 s
  14			72 °C, 1 min

• 34

  After the reaction is complete, pool the PCR reactions and purify the PCR product by using the QIAquick PCR purification kit according to the manufacturer’s directions.

• 35

  Quantify the purified PCR product and run 2 μg of the product on a 2% (wt/vol) agarose gel. Successful reactions should yield a ~260–270bp product for the knockout library and a ~270–280bp product for the activation library. Gel extract using the QIAquick gel extraction kit according to the manufacturer’s directions.

  Pause Point Gel-extracted samples can be stored at −20 °C for several months.

• 36

  Quantify the gel-extracted samples using the Qubit dsDNA HS Assay Kit according to the manufacturer’s instructions.

• 37

  Sequence the samples on the Illumina MiSeq or NextSeq according to the Illumina user manual with 80 cycles of read 1 (forward) and 8 cycles of index 1. We recommend sequencing with 5% PhiX control on the MiSeq or 20% PhiX on the NextSeq to improve library diversity and aiming for a coverage of >100 reads per sgRNA in the library.

• 38

  Analyze sequencing data with count_spacers.py. We provide a python script for analyzing the NGS results for the sgRNA representation (Supplementary Data 3). Install python 2.7 (https://www.python.org/downloads/) and biopython (http://biopython.org/DIST/docs/install/Installation.html). Prepare a csv file containing the guide spacer sequences with each line corresponding to one sequence.

• 39

  To determine the spacer distribution, run python count_spacers.py with the following optional parameters:

  Flag	Description	Default
  -f	Fastq file containing NGS data for analysis	NGS.fastq
  -o	Output csv file with guide spacer sequences in the first column and respective read counts in the second column	library_count.csv
  -i	Input csv file with guide spacer sequences	library_sequences.csv
  -no-g	Indicate absence of a guanine before the guide spacer sequence	guanine is present

  After running count_spacers.py, spacer read counts will be written to an output csv file. Relevant statistics including the number of perfect guide matches, non-perfect guide matches, sequencing reads without key, the number of reads processed, percentage of perfectly matching guides, percentage of undetected guides, and skew ratio will be written to statistics.txt. An ideal sgRNA library should have more than 70% perfectly matching guides, less than 0.5% undetected guides, and a skew ratio of less than 10.

  Critical Step The human SAM libraries do not have a guanine before the guide spacer sequence, so make sure to run the script with the parameter -no-g when analyzing those libraries.

  Troubleshooting

Lentivirus production and titer o TIMING 1–2 w

• 40

  Perform an antibiotic kill curve. Prior to lentivirus production and titer, we recommend performing a kill curve for the antibiotic used to select the sgRNA library and additional necessary components on the relevant cell line for screening. To do so, seed cells at 10% confluency in media containing a range of antibiotic concentrations typically used for selection.

• 41

  Refresh media with antibiotic every 3 days. After 4–7 days, choose the lowest concentration of antibiotic sufficient to kill all cells.

  Critical Step It is important to use the lowest concentration of antibiotic to avoid excessively stringent selection that biases selection for cells transduced with multiple sgRNAs.

• 42

  HEK 293FT maintenance. Culture cells in D10 medium at 37 °C with 5% CO₂ and maintain according to the manufacturer’s recommendation.

• 43

  To passage, aspirate the medium and rinse the cells by gently adding 5 ml of TrypLE to the side of the T225 flask, so as not to dislodge the cells. Remove the TrypLE and incubate the flask for 4–5 min at 37 °C until the cells have begun to detach. Add 10 ml of warm D10 to the flask and dissociate the cells by pipetting them up and down gently, and transfer the cells to a 50-ml Falcon tube.

  Critical Step We typically passage cells every 1–2 d at a split ratio of 1:2 or 1:4, never allowing cells to reach more than 70% confluency. For lentivirus production, we recommend using HEK 293FT cells with a passage number less than 10.

• 44

  Preparation of cells for transfection. Seed the well-dissociated cells into T225 flasks 20–24 h before transfection at a density of 1.8 × 10⁷ cells per flask in a total volume of 45 ml D10 medium. Refer to the following table for the number of T225 flasks recommended for each plasmid construct:

  Plasmid construct	Number of T225 flasks
  sgRNA library	4
  Additional Cas9 nuclease or activator components	2 per component
  GFP transfection control	1

  Critical Step Do not plate more cells than the recommended density, as doing so may reduce transfection efficiency.

• 45

  Lentivirus plasmid transfection. Cells in T225 flasks from Step 44 are optimal for transfection at 80–90% confluency. We outline below a transfection method using Lipofectamine 2000 and PLUS reagent. Alternatively, we describe a cost-effective method for lentivirus transfection with Polyethylenimine (PEI) in Box 5. For each lentiviral target, combine the following lentiviral target mix in a 15-ml or 50-ml Falcon tube and scale up accordingly:

  Box 5

  Lentivirus production with Polyethylenimine

  1. Prepare polyethylenimine (PEI) transfection reagent. Dissolve 50 mg PEI Max in 45 ml UltraPure Water. Adjust pH to 7.1 by adding 10 M NaOH dropwise until the pH approaches 6 and then by adding 1 M NaOH dropwise until final pH reaches 7.1. Adjust final volume to 50 ml with UltraPure Water. Sterilize using Millipore’s 0.45 μm Steriflip filter. Prepare 50 × 1 ml aliquots and store at −20 °C until use. PEI is stable for up to one year and can undergo 5 freeze-thaw cycles without a drop in transfection efficiency.

  2. Lentivirus plasmid transfection. Prepare HEK293FT cells for lentivirus transfection as described in Steps 42–44.

  3. For each lentiviral target, combine the following lentiviral target mix in a 50-ml Falcon tube and scale up accordingly:

     Component	Amount per T225 flask	Final Concentration
     DMEM (serum free)	651 μl
     pMD2.G (lentiviral helper plasmid)	3.4 μg	5.2 μg ml−1
     psPAX2 (lentiviral helper plasmid)	6.8 μg	10.4 μg ml−1
     Lentiviral target plasmid	μg	20.9 μg ml−1

  4. Add 195 μl PEI transfection reagent, vortex, and incubate at room temperature for 10 min.

  5. Add 25 ml D10 media to the transfection reagent mixture.

  6. Aspirate old media from cells, gently add new media containing the transfection reagent mixture and shake gently to mix. Return the T225 flask to the incubator.

  7. 2 d after transfection, harvest and store lentivirus as described in Step 52.

  Component	Amount per T225 flask
  Opti-MEM	2250 μl
  pMD2.G (lentiviral helper plasmid)	15.3 μg
  psPAX (lentiviral helper plasmid)	23.4 μg
  Lentiviral target plasmid	30.6 μg

  Critical Step Transfecting at the recommended cell density is crucial for maximizing transfection efficiency. Lower densities can result in Lipofectamine 2000 toxicity for cells, while higher densities can reduce transfection efficiency.

• 46

  Prepare the PLUS reagent mix as follows and invert to mix:

  Component	Amount per T225 flask
  Opti-MEM	2250 μl
  PLUS reagent	297

• 47

  Add the PLUS reagent mix to the lentiviral target mix, invert, and incubate at room temperature for 5 min.

• 48

  Prepare the Lipofectamine reagent mix as follows and invert to mix:

  Component	Amount per T225 flask
  Opti-MEM	4500 μl
  Lipofectamine 2000	270

• 49

  Add the lentiviral target and PLUS reagent mix to the Lipofectamine reagent mix, invert, and incubate at room temperature for 5 min.

• 50

  Pipette 9 ml of the lentiviral transfection mix from Step 49 into each T225 flask from Step 44 and shake gently to mix. Return the T225 flasks to the incubator.

• 51

  After 4 h, replace the medium with 45 ml of pre-warmed D10 medium. The constitutive GFP expression plasmid transfection control indicates transfection efficiency.

  Troubleshooting

• 52

  Harvest and store lentivirus. 2 d after the start of lentiviral transfection, pool the lentivirus supernatant from the T225 flasks transfected with the same plasmid construct and filter out cellular debris using Millipore’s 0.45 μm Stericup filter unit.

  Pause Point The filtered lentivirus supernatant can be aliquoted and stored at −80 °C. Avoid freeze-thawing lentivirus supernatant.

• 53

  Determine the lentiviral titer through transduction. The CRISPR-Cas9 system has been used in a number of mammalian cell lines. Conditions may vary for each cell line. Lentiviral titer should be determined using the relevant cell line for the screen. Below we detail transduction conditions and calculation of viral titer for HEK 293FT cells (option A) and hESC HUES66 cells (option B).

  1. Lentiviral transduction and titer for HEK 293FT cells by spinfection

     1. HEK 293FT maintenance and passaging. Refer to Steps 42–43.

     2. Preparation of cells for spinfection. For each lentivirus, seed 6 wells of a 12-well plate at a density of 3 × 10⁶ cells in 2 ml D10 medium per well with 8 μg ml⁻¹ of polybrene. In each well, add 400 μl, 200 μl, 100 μl, 50 μl, 25 μl, or 0 μl of lentivirus supernatant from Step 52. Mix each well thoroughly by pipetting up and down.

     3. Spinfect the cells by centrifuging the plates at 1000 × g for 2 h at 33 °C. Return the plates to the incubator after spinfection.

     4. Replating spinfection for calculation of viral titer. 24 h after the end of spinfection, remove the medium, gently wash with 400 μl TrypLE per well, add 100 μl of TrypLE, and incubate at 37 °C for 5 min to dissociate the cells. Add 2 ml of D10 medium per well and resuspend the cells by pipetting up and down.

     5. Determine the cell concentration using the Cellometer Image Cytometer for the 0 μl lentivirus supernatant condition.

     6. For each virus condition, seed 4 wells of a 96-well clear bottom black tissue culture plate at a density of 4 × 10³ cells (from Step 53Aiv) based on the cell count determined in Step 53Av in 100 μl of D10 medium. Add an additional 100 μl of D10 medium with the corresponding selection antibiotic for the virus at an appropriate final concentration to 2 wells and 100 μl of regular D10 medium to the other 2 wells.

     7. 72–96 h after replating, when the no virus conditions contain no viable cells and the no antibiotic selection conditions are at 80–90% confluency, quantify the cell viability for each condition using CellTiter Glo according to the manufacturer’s protocol.

        Critical Step We have found that Cell Titer Glo can be diluted 1:4 in PBS to reduce cost while still achieving optimal results.

     8. For each virus condition, calculate the multiplicity of infection (MOI) as the average luminescence, or viability, of the 2 wells in the condition with antibiotic selection divided by the average luminescence of the 2 wells in the condition without antibiotic selection. A linear relationship between lentivirus supernatant volume and MOI is expected at lower volumes, with saturation achieved at higher volumes.

  2. Lentiviral transduction and titer for hESC HUES66 cells by mixing

     1. HUES66 maintenance. We routinely maintain HUES66 cells (a hESC cell line) in feeder-free conditions with mTeSR1 medium on GelTrex-coated tissue culture plates. To coat a 100-mm tissue culture dish, dilute cold GelTrex 1:100 in 5 ml of cold DMEM, cover the entire surface of the culture dish, and place the dish in the incubator for at least 30 min at 37 °C. Aspirate the GelTrex mix prior to plating. During passaging and plating, mTeSR1 medium is supplemented further with 10 μM ROCK inhibitor. Refresh the mTeSR1 medium daily.

     2. Passaging HUES66. Aspirate the medium and rinse the cells once by gently adding 10 ml of DPBS to the side of the 100-mm tissue culture dish, so as not to dislodge the cells. Dissociate the cells by adding 2 ml of Accutase and incubate at 37 °C for 3–5 min until the cells have detached. Add 10 ml of DMEM, resuspend the dissociated cells, and pellet the cells at 200 × g for 5 min. Remove the supernatant, resuspend the cells in mTeSR1 medium with 10 μM ROCK inhibitor and replate the cells onto GelTrex-coated plates. Replace with normal mTeSR1 medium 24 h after plating.

        Critical Step We typically passage cells every 4–5 d at a split ratio of 1:5 or 1:10, never allowing cells to reach more than 70% confluency.

     3. Preparation of cells for lentiviral transduction. For each lentivirus, plate 6 wells of a Geltrex-coated 6-well plate at a density of 5 × 10⁵ cells in 2 ml mTeSR1 medium per well. In each well, add 400 μl, 200 μl, 100 μl, 50 μl, 25 μl, or 0 μl of lentivirus supernatant, fill to a total volume of 3 ml with DPBS, and supplement with 10 μM ROCK inhibitor. Plate an additional no antibiotic selection control well at the same seeding density without virus. Mix each well thoroughly by pipetting up and down.

     4. 24 h after lentiviral transduction, replace the medium with mTeSR1 containing the relevant antibiotic selection. For the no antibiotic selection control well, replace the medium with normal mTeSR1 medium. Refresh the mTeSR1 medium with and without antibiotic selection every day until the plate is ready for the next step.

     5. Calculation of viral titer. 72–96 h after starting the antibiotic selection, when the no virus condition contains no viable cells and the no antibiotic selection control condition is 80–90% confluent, rinse the cells with 2 ml of DPBS, add 500 μl of Accutase, and incubate at 37 °C for 3–5 min to dissociate the cells. Add 2 ml of DMEM and mix well.

     6. Count and record the number of cells in each well using the Cellometer Image Cytometer.

     7. For each virus condition, calculate the MOI as the number of cells in the antibiotic selection condition divided by the number of cells in the no antibiotic selection control. A linear relationship between lentivirus supernatant volume and MOI is expected at lower volumes, with saturation achieved at higher volumes.

Troubleshooting

Lentiviral transduction and screening o TIMING 3–6 w

CRITICAL: Skip to Step 56 if screening using a 1-vector format.

• 54

  Generation of a cell line with stably expressed Cas9 components. Prior to transducing the sgRNA library, transduce the relevant cell line with the additional Cas9 components that are not present in the sgRNA library backbone at an MOI < 0.7. If two additional Cas9 components are required, for instance dCas9-VP64 and MS2-p65-HSF1, both components can be transduced at the same time. Scale up as necessary to generate sufficient cells for maintaining sgRNA representation after sgRNA library transduction and selection. We have found that generation of a clonal line with Cas9 or SAM components is not necessary for successful screening. The cells can therefore be transduced and selected as a bulk population at the desired scale. Below we describe lentiviral transduction and cell line generation methods for HEK 293FT cells (option A) and hESC HUES66 cells (option B).

  1. Generation of HEK 293FT cell lines

     1. Seed cells in 12-well plates at a density of 3 × 10⁶ cells in 2 ml D10 medium per well with 8 μg ml⁻¹ of polybrene. Add the appropriate volume of lentivirus supernatant from Step 52 to each well, and make sure to include a no virus control. Mix each well thoroughly by pipetting up and down.

     2. Spinfect the cells by spinning the plates at 1000 × g for 2 h at 33 °C. Return the plates to the incubator after spinfection.

     3. 24 h after the end of spinfection, remove the medium, gently wash with 400 μl TrypLE per well, add 100 μl of TrypLE, and incubate at 37 °C for 5 min to dissociate the cells. To each well, add 2 ml of D10 medium with the appropriate selection antibiotic for the lentivirus and resuspend the cells by pipetting up and down.

     4. Pool the resuspended cells from the wells with virus and seed the cells into T225 flasks at a density of 9 × 10⁶ cells per flask in 45 ml of D10 medium with selection antibiotic.

     5. Transfer the resuspended cells from the no virus control into a T75 and add 13 ml of D10 medium with selection antibiotic.

     6. Refresh the selection antibiotic every 3 d and passage as necessary for 4–7 d and until there are no viable cells in the no virus control.

  2. Generation of HUES66 cell lines

     1. Seed cells in Geltrex-coated 6-well plates at a density of 5 × 10⁵ cells in of 2 ml mTeSR1 medium per well. Add the appropriate volume of lentivirus supernatant from Step 52 to each well, and make sure to include a no virus control. Fill up the total volume to 3 ml with DPBS, and supplement with 10 μM ROCK inhibitor. Mix each well thoroughly by pipetting up and down.

     2. 24 h after lentiviral transduction, replace the medium with mTeSR1 containing the relevant selection antibiotic. Refresh the mTeSR1 medium with selection antibiotic every day and passage as necessary for 4–7 d and until there are no viable cells in the no virus control.

  Critical Step The lentiviral transduction method for generating a cell line for screening should be consistent with the method for titering the virus to ensure that cells are transduced at the appropriate MOI.

• 55

  After selecting for successfully transduced cells, allow the cells to recover from selection by culturing in normal medium for 2–7 d before transducing with the sgRNA library. If culturing for more than 7 d after selection or after freezing cells, re-select the Cas9 component cell line with the appropriate selection antibiotic to ensure expression of the Cas9 components and allow the cells to recover before sgRNA library transduction.

  Pause Point Cells can be frozen according to the manufacturer’s protocol.

• 56

  Transduction of cells with the sgRNA library. Repeat Steps 54–55 for lentiviral sgRNA library transduction at the appropriate MOI and selection of transduced cell lines. To ensure that most cells receive only one genetic perturbation, transduce the sgRNA library at an MOI < 0.3. Scale up the transduction such that the sgRNA library has a coverage of >500 cells expressing each sgRNA. For example, for a library size of 100,000 unique sgRNAs, transduce 1.67 × 10⁸ cells at an MOI of 0.3. After the appropriate selection for 4–7 days, the cells are ready for screening. For knockout screening, we have found that maximal knockout efficiency is achieved 7 days after sgRNA transduction and therefore recommend selecting for 7 days before starting the screen selection. In contrast, maximal SAM activation is achieved as early as 4 days after sgRNA transduction. If selection is complete based on the no virus control, gain-of-function screening can be started 5 days after transduction. We generally recommend to perform 4 independent screening bioreps (i.e. 4 separate sgRNA library infections followed by separate screening selection). Multiple screening bioreps are critical for determining screening hits with a high rate of validation. Since the parameters of each screen depends on the screening phenotype of interest, we provide guidelines and technical considerations for the screening selection process (Box 2–4).

  Critical Step It is important to aim for a coverage of >500 cells per sgRNA to guarantee that each perturbation will be sufficiently represented in the final screening readout. Increase the coverage as necessary if the screening selection pressure is not very strong or if performing a negative selection screen. Transducing the sgRNA library at an MOI < 0.3 ensures that most cells receive at most one genetic perturbation. Transducing at higher MOI’s may confound screening results.

Harvest genomic DNA for screening analysis o TIMING 5–7 d

• 57

  Harvest genomic DNA. At the end of the screen, harvest genomic DNA (gDNA) from a sufficient number of cells to maintain a coverage of >500. For a library size of 100,000 unique sgRNAs, harvest gDNA from at least 5 × 10⁷ cells for downstream sgRNA analysis using the Zymo Research Quick-gDNA MidiPrep according to the manufacturer’s protocol. Elution should be performed twice with 150–200 μl each for maximum recovery of gDNA.

  Critical Step Make sure to tighten the connection between the reservoir and the column and centrifuge at a sufficient speed and time to remove any residual buffer. Addition of a final dry spin is recommended to remove residual wash buffer.

  Pause Point Frozen cell pellets or isolated gDNA can be stored at −20 °C for several months.

• 58

  Preparation of the gDNA for NGS analysis. Refer to Steps 32–33 for how to amplify the sgRNA for NGS. Scale up the number of reactions such that all of the gDNA harvested from the screen is amplified. Each 50 μl reaction can hold up to 2.5 μg of gDNA. Barcoded NGS-Lib-Rev primers enable sequencing of different screening conditions and bioreps (i.e. experimental condition biorep 1 and control condition biorep 1) in a pooled sequencing run.

  Troubleshooting

• 59

  Purification of amplified screening NGS library. For large-scale PCR purification, we recommend using the Zymo-Spin V with Reservoir. Add 5 volumes of DNA Binding Buffer to the PCR reaction, mix well, and transfer to Zymo-Spin V with Reservoir in a 50 ml Falcon tube. Each Zymo-Spin V column can hold up to 12 ml.

  Critical Step Make sure to tighten the connection between the reservoir and the Zymo-Spin V column.

• 60

  Centrifuge at 500 × g for 5 min at room temperature. Discard the flow-through.

• 61

  Add 2 ml of DNA Wash Buffer and centrifuge at 500 × g for 5 min at room temperature. Discard the flow-through and repeat for an additional wash.

• 62

  Remove the reservoir from the Zymo-Spin V column and transfer the column to a 2 ml collection tube. In a microcentrifuge, spin at the maximum speed (>12,000 × g) for 1 min at room temperature to remove residual wash buffer.

• 63

  Transfer the Zymo-Spin V column to a 1.5 ml microcentrifuge tube. Add 150 μl of elution buffer, wait for 1 min, and spin at the maximum speed (>12,000 × g) for 1.5 min at room temperature to elute the purified PCR reaction.

• 64

  Pool the purified PCR reactions and quantify. Refer to Steps 37–39 for NGS analysis of the sgRNA distribution. For screening NGS analysis, we recommend aiming for a coverage of >500 reads per sgRNA in the library.

• 65

  Analysis of screening results with RNAi gene enrichment ranking (RIGER). Prior to RIGER analysis, determine the sgRNA fold change due to screening selection. For each biorep of screening experimental or control condition, add a pseudocount of 1 to the NGS read count of each sgRNA and normalize by the total number of NGS read counts for that condition. To obtain the sgRNA fold change, divide the experimental normalized sgRNA count by the control and take the base 2 logarithm.

• 66

  Prepare a RIGER input csv file with the column headers WELL_ID, GENE_ID, and biorep 1, biorep 2, etc from left to right. WELL_ID is a list of sgRNA identification numbers, GENE_ID the genes that the sgRNAs target, and biorep columns the sgRNA fold change. Each row contains a different sgRNA in the library.

• 67

  RIGER is launched through GENE-E from the Broad Institute (http://www.broadinstitute.org/cancer/software/GENE-E/download.html). Start GENE-E and import the input csv file by navigating to File > Import > Ranked Lists. Click the table cell containing the first data row and column as instructed. Launch RIGER by going to Tools > RIGER. Adjust the RIGER settings to the following recommended values:

  Number of permutations: 1,000,000

  Method to convert hairpins to genes: Kolmogorov-Smirnov

  Gene rank order: Positive to negative for positive selection screens; negative to positive for negative selection screens

  Select adjust gene scores to accommodate variation in hairpin set size

  Select hairpins are pre-scored

  Hairpin Id: WELL_ID

  Convert hairpins to: GENE_ID

• 68

  Once the RIGER analysis has completed, export the gene rank dataset. Determine the top candidates genes based on either the overlap or the average ranking between the screening bioreps.

Validation of candidate genes for screening phenotype o TIMING 4–5 w

• 69

  Cloning validation sgRNAs into the plasmid backbone of the sgRNA library. Design top and bottom strand primers for cloning the top 3 sgRNAs for each candidate gene individually into the plasmid backbone of the sgRNA library used for screening according to Table 5 as we have previously described⁷². Primers for cloning 2 non-targeting sgRNAs (NT1 and NT2) for control are also provided in Table 5.

• 70

  Resuspend the top and bottom strand primers to a final concentration of 100 μM. Prepare the following mixture for phosphorylating and annealing the top and bottom strand primers for each validation sgRNA:

  Component	Amount (μl)	Final concentration
  sgRNA-top, 100 μM	1	10 μM
  sgRNA-bottom, 100 μM	1	10 μM
  T4 ligation buffer, 10×	1	1×
  T4 PNK	0.5
  UltraPure water	6.5
  Total	10

• 71

  Phosphorylate and anneal the primers in a thermocycler using the following conditions: 37 °C for 30 min; 95 °C for 5 min; ramp down to 25 °C at 5 °C min⁻¹.

• 72

  After the annealing reaction is complete, dilute the phosphorylated and annealed oligos 1:10 by adding 90 μl of UltraPure water.

  Pause Point Annealed oligos can be stored at −20 °C for at least 1 week.

• 73

  Clone the annealed sgRNA inserts into the sgRNA library backbone by setting up a Golden Gate assembly reaction for each sgRNA. We have found that when cloning many sgRNAs, Golden Gate assembly is efficient and offers a high cloning success rate. Mix the following for each sgRNA:

  Component	Amount (μl)	Final concentration
  Rapid Ligase Buffer, 2×	12.5	1×
  FastDigest Esp3I (BsmBI)	1
  DTT	0.25	1 mM
  BSA, 20 mg ml−1	0.125	0.1 mg ml−1
  T7 ligase	0.125
  Diluted oligo duplex from Step 72	1	0.04 μM
  sgRNA library backbone	1	1 ng μl−1
  UltraPure water	9
  Total	25

  Critical Step We recommend using FastDigest Esp3I (Fermentas) as we have had reports of Esp3I from other vendors not working as efficiently in the Golden Gate assembly reaction setup described. It is not necessary to perform a negative control (no insert) Golden Gate assembly reaction as it will always contain colonies and therefore is not a good indicator of cloning success.

• 74

  Perform a Golden Assembly reaction using the following cycling conditions:

  Cycle number	Condition
  1–15	37 °C for 5 min, 20 °C for 5 min

  Pause Point Completed Golden Gate assembly reactions can be stored at −20 °C for at least 1 week.

• 75

  Transformation and midiprep. Transform the Golden Gate assembly reaction into a competent E. coli strain, according to the protocol supplied with the cells. We recommend the Stbl3 strain for quick transformation. Thaw the chemically competent Stbl3 cells on ice, add 2 μl of the product from Step 74 into ice-cold Stbl3 cells, and incubate the mixture on ice for 5 min. Heat-shock the mixture at 42 °C for 30 s and return to ice immediately for 2 min. Add 100 μl of SOC medium and plate it onto a standard LB agar plate (100 mm Petri dish, ampicillin). Incubate it overnight at 37 °C.

• 76

  The next day, inspect the plates for colony growth. Typically, there should be tens to hundreds of colonies on each plate.

  Troubleshooting

• 77

  From each plate, pick 1 or 2 colonies for midiprep to check for the correct insertion of sgRNA and for downstream lentivirus production. To prepare a starter culture for midiprep, use a sterile pipette tip to inoculate a single colony into a 3-ml culture of LB medium with 100 μg ml⁻¹ ampicillin. Incubate the starter culture and shake it at 37 °C for 4–6 h at >250 rpm.

• 78

  Expand each starter culture by transferring the starter culture to 2 separate 25-ml cultures of LB medium with 100 μg ml⁻¹ ampicillin in a 50-ml Falcon tube. Remove the cap and seal the top of the tube with AirPore Tape Sheets. Incubate the culture and shake it at 37 °C overnight at >250 rpm.

• 79

  12–16 h after seeding the starter culture, isolate the plasmids using an endotoxin-free midiprep kit such as the Macherey-Nagel NucleoBond Xtra Midi EF kit according to the manufacturer’s protocol.

  Critical Step Using an endotoxin-free plasmid purification kit is important for avoiding endotoxicity in virus preparation and mammalian cell culture. In our experience, plasmids prepared with endotoxin-free midiprep have higher purity and produce higher lentiviral titers.

  Pause Point Midiprepped validation sgRNA constructs can be stored at −20 °C for at least 1 year.

• 80

  Sequence validation of sgRNA cloning. Verify the correct insertion of the validation sgRNAs by sequencing from the U6 promoter using the U6-fwd primer. Compare the sequencing results to the sgRNA library plasmid sequence to check that the 20-nt sgRNA target sequence is properly inserted between the U6 promoter and the remainder of the sgRNA scaffold.

  Troubleshooting

• 81

  Generation of validation cell lines. Prepare lentivirus for validation by scaling down the lentivirus production in Steps 44–51 to T25 flasks or 2 wells of a 6-well plate. Filter the lentivirus supernatant using 5-ml syringes and 0.45 μm syringe filters.

• 82

  Titer the lentivirus according to Step 53. If preparing multiple validation sgRNA lentivirus in the same plasmid backbone at the same time, titer lentivirus from 2–3 different sgRNAs and extend the average titer to the rest of the lentivirus.

• 83

  Similar to during screening, transduce either naive cells or Cas9 component-expressing cells with validation sgRNA lentivirus at an MOI < 0.5 according to Steps 54–55. For knockout validation, select for 7 d to allow for sufficient time for indel saturation.

• 84

  Validation of candidate genes for screening phenotype. Once the antibiotic selection for validation cell lines is complete, verify the screening phenotype by applying the screening selection on the validation cell lines and assessing cell proliferation, death, or fluorescence for positive, negative, and marker gene selection screens respectively. In addition, determine the indel rate for knockout screens (Steps 85–99) or fold activation for activation screens (Steps 100–110).

• 85

  Indel rate analysis for validating a knockout screen. We describe a two-step PCR for NGS in which the first step uses custom primers to amplify the genomic region of interest and the second step uses universal, barcoded primers for multiplexed sequencing of up to 96 different samples in the same NGS run. For each validation sgRNA, design custom round 1 NGS primers (NGS-indel-R1) that amplify the 100–300bp region centered around the sgRNA cut site according to Table 4. It is important to design primers situated at least 50 bp from the target cleavage site to allow for the detection of longer indels. Aim for an annealing temperature of 60 °C and check for potential off-target sites using Primer-BLAST. If necessary, include a 1–10bp staggered region to increase the diversity of the library.

• 86

  Harvest gDNA from validation cell lines. Seed the validation cells at a density of 60% confluency with 3 bioreps in a 96-well clear bottom black tissue culture plate.

• 87

  1 d after seeding, when the cells have reached confluency, aspirate the media and add 50 μl of QuickExtract DNA Extraction Solution. Incubate at room temperature for 2–3 min.

• 88

  Scrape the cells with a pipette tip, mix thoroughly by pipetting up and down, and transfer the mixture to a 96-well PCR plate.

• 89

  Extract the genomic DNA by running the following cycling conditions:

  Cycle number	Condition
  1	65 °C, 15 min
  2	68 °C, 15 min
  3	98 °C, 10 min

  Pause Point Extracted genomic DNA can be stored at −20 °C for up to several months.

• 90

  First round PCR for indel analysis by NGS. Amplify the respective target regions for each validation and control cell line by using custom NGS-indel-R1 primers (Table 4) in the following reaction:

  Component	Amount (μl)	Final concentration
  KAPA HiFi HotStart ReadyMix, 2×	10	1×
  First round PCR from Step 91	1
  NGS-indel-R2-Fwd	1	0.5 μM
  NGS-indel-R2-Rev	1	0.5 μM
  UltraPure water	7
  Total	20

  Critical Step To minimize error in amplifying sgRNAs, it is important to use a high-fidelity polymerase. Other high-fidelity polymerases, such as PfuUltra II (Agilent) or NEBNext (New England BioLabs), may be used as a substitute.

• 91

  Perform a PCR with the following cycling conditions:

  Cycle number	Denature	Anneal	Extend
  1	98 °C, 3 min
  2–23	98 °C, 10 s	63 °C, 10 s	72 °C, 25 s
  14			72 °C, 2 min

• 92

  Second round PCR for indel analysis by NGS. Barcode the first round PCR for NGS by amplifying the product with different NGS-indel-R2 primers (Table 4) in the following reaction:

  Component	Amount (μl)	Final concentration
  KAPA HiFi HotStart ReadyMix, 2×	10	1×
  QuickExtract from Step 89	1
  NGS-indel-R1-Fwd	1	0.5 μM
  NGS-indel-R1-Rev	1	0.5 μM
  UltraPure water	7
  Total	20

• 93

  Perform a PCR using the same cycling conditions as described in Step 91.

• 94

  After the reaction is complete, run 5 μl of each amplified target on a gel to verify successful amplification of a single product at the appropriate size. Cast a 2% (wt/vol) agarose gel cast in TBE buffer with SYBR Safe dye and run the gel at 15 V cm⁻¹ for 30 min.

  Troubleshooting

• 95

  Pool the PCR products and purify the pooled product using the QIAquick PCR purification kit, according to the manufacturer’s instructions.

  Critical Step Due to variable PCR efficiencies and product lengths, pooling without normalization may result in variation in NGS representation. When pooling without normalization, aim for 20,000–40,000 reads per sgRNA during sequencing. Alternatively, if sequencing reads are limited, consider purifying each barcoded PCR product separately, quantifying by NanoDrop, and normalizing the PCR products to the same concentration prior to pooling.

• 96

  Run the pooled PCR product on a 2% (wt/vol) agarose gel as described in Step 94 and gel extract the appropriately sized bands using the QIAquick gel extraction kit according to the manufacturer’s directions.

  Pause Point Gel-extracted product can be stored at −20 °C for several months.

• 97

  Sequence gel-extracted samples on the Illumina MiSeq according to the Illumina user manual with 260 cycles of read 1, 8 cycles of index 1, and 8 cycles of index 2. We recommend aiming for >10,000 reads per sgRNA.

• 98

  Indel analysis of validation sgRNAs with calculate_indel.py. We provide a python script for analyzing the NGS results for indel rates (Supplementary Data 4). Install python 2.7 (https://www.python.org/downloads/), biopython (http://biopython.org/DIST/docs/install/Installation.html), and SciPy (https://www.scipy.org/install.html). Construct a sample sheet with each line corresponding to a separate sample. Each line should contain sample name, fasta or fastq file name, guide sequence, PCR target amplicon, and experimental or control in columns from left to right. The last column is only required when performing the maximum likelihood estimate (MLE) correction. When MLE is performed, control samples which reflect the background indel rate should be labeled “Control” and experimental samples should be labeled “Experimental”. Refer to the following table for an example of a sample sheet:

  example1	example1.fastq	GCCCGATCGCTATATCCACG	TGTATATACCTCGCGCCTAACTGCCAGCTGACCACGCCGTACAGGTTCTGTTGTCTACTGATGCATTACATCTCCTTAGGGTACTTCCGCTGAGATCATTGCCCGATCGCTATATCCACGCGTTTGGCTCGTTCAACCAGTCCAACCGACTCGTTGGTCTGGTAATGTGCCCAAGTTAAGGTGAGTATGGACATGGCGGG	Experimental
  example2	example2.fastq	CGAGATAAGTCAGCAGGGGC	CTCTTCTGCTCAAGCGAGTTCCCAGAGGTCCTTGCCGAGGGGGTTATATCGATCCACGAAACATAGTATGTAATACGAAAGTCATCGGCGCCTATGCCCTCGAGATAAGTCAGCAGGGGCTTTTCGTACATTTTCCAAGATTCGGGATTGACGTTGCATCGCAAGCTAATTGGTTACCATTAGACCCCAGTCCTCAGCCC	Experimental
  example3	example3.fastq	CACCCACACCAACCGCAGAA	CTGGGTTTAACCGAGCTAGTCCTGAAGATCTTGAGTAACTGCACATGTAAATAATCCGAGGCGTTTTCGGCGCCTAGCATGGCGTGCAAGCTCTCCGCAGCACCCACACCAACCGCAGAAGACAGCCCCTGGGACGTGTAATTTAGCCATGTTGGTCGCTTTCGGGAGCAACAGTGGTGTGGCCGTAGCGGACACCACCA	Control

• 99

  If processing all files with a single command, run python calculate_indel.py with the following optional parameters:

  Flag	Description	Default
  -f	Indicates input file is fasta format	Fastq file format
  -a	Uses alternative hashing algorithm for calculation74	Ratcliff-Obershelp based algorithm73
  -o	Output file with calculated indel rates and statistics	calc_indel_out.csv
  -i	Input file with sample name, fasta or fastq file name, guide sequence, PCR target amplicon, and experimental or control in columns from left to right	sample_sheet.csv
  -v or -q	Increase or decrease reporting as script runs	Standard reporting
  -no-m	Does not perform MLE correction	MLE correction is performed

  For processing individual samples, such as in the case of parallelization, run python calculate_indel.py –sample <sample name> to produce a file <sample name>_out.csv. Combine individual sample files by calling python calculate_indel.py --combine. After running calculate_indel.py, calculated indels will be in the output file, which also contains counts of reads that matched perfectly, failed to align, or were rejected due to quality, or had miscalled bases/replacements. There will also be three columns corresponding to the MLE corrected indel rate, as well as the upper and lower bounds for the 95% confidence interval of indels.

• 100

  Determine the fold activation for validating an activation screen. Prepare cells by seeding the validation cells at a density of 60% confluency with 4 bioreps for each validation cell line in a 96-well poly-d-lysine coated tissue culture plate.

• 101

  Reverse transcription to cDNA. When the cells are confluent approximately 1 d after seeding, prepare the following reagents for each well: Complete RNA lysis buffer:

  Component	Amount (μl)	Final concentration
  RNA lysis buffer	100
  Proteinase K, 300 U ml−1	1	3 U ml−1
  DNAse I, 50 KU ml−1	0.6	300 U ml−1
  Total	101.6

  Reverse Transcription Mix:

  Component	Amount (μl)	Final concentration
  Reaction Buffer, 5×	5	1×
  dNTP Mix, 10 mM	1.25	0.5 mM
  Random Hexamer Primer, 100 μM	1.09	4.4 μM
  Oligo dT, 100 μM	0.88	3.5 μM
  RiboLock RNAse Inhibitor, 40 U μl−1	0.125	0.2 U μl−1
  RevertAid Reverse Transcriptase, 200 U μl−1	1.25	10 U μl−1
  UltraPure water	10.41
  Total	20

  Except for Oligo dT, all components can be found in the Thermo RevertAid RT Reverse Transcription kit.

  Critical Step Make sure all reagents are RNAse free and take proper precautions when working with RNA.

• 102

  Aliquot 20 μl of the Reverse Transcription Mix into each well of a 96-well PCR plate. Thaw the RNA lysis stop solution, prepare cold DPBS, and keep all reagents except for the complete RNA lysis buffer on ice until needed.

• 103

  Aspirate the media from each well of the 96-well poly-d-lysine tissue culture plate from Step 100, wash with 100 μl of cold DPBS, and add 100 μl of room temperature complete RNA lysis buffer from Step 101. Incubate at room temperature while mixing thoroughly for 6–12 min to lyse the cells.

  Critical Step It is important to limit the lysis time to less than 12 min to prevent RNA degradation.

• 104

  Transfer 30 μl of the cell lysate to a new 96-well PCR plate. Add 3 μl of RNA lysis stop solution to terminate lysis and mix thoroughly.

  Pause Point The cell lysate with RNA lysis stop solution can be stored at −20 °C for additional reverse transcription reactions.

• 105

  Then, add 5 μl of the cell lysate with RNA lysis stop solution to the Reverse Transcription Mix from Step 101 for a total volume of 25 μl and mix thoroughly.

• 106

  Reverse transcribe the harvested RNA to cDNA with the following cycling conditions:

  Cycle number	Condition
  1	25 °C, 10 min
  2	37 °C, 60 min
  3	95 °C, 5 min

  Pause Point The cDNA can be stably stored at −20 °C for 1 year.

• 107

  Perform a TaqMan qPCR for fold activation analysis. Thermo Fisher Scientific provides design ready TaqMan Gene Expression Assays for candidate genes as well as for endogenous control genes such as GAPDH or ACTB. Make sure that the experimental and control gene expression assays have different probe dyes (i.e. VIC and FAM dyes) that allow for running in the same reaction. Prepare the following qPCR master mix per reverse transcription reaction. We recommend pre-mixing the TaqMan Fast Advanced Mastermix and gene expression assays for all samples with the same target gene first.

  Component	Amount (μl)	Final concentration
  TaqMan Fast Advanced Master Mix, 2×	12	1×
  TaqMan Gene Expression Assays for candidate gene, 20×	1.2	1×
  TaqMan Gene Expression Assays for control gene, 20×	1.2	1×
  cDNA	9.6
  Total	24

• 108

  Aliquot 4 × 5 μl of the qPCR master mix into a 384-well optical plate for technical replicates.

  Cycle number	Hold	Denature	Anneal/Extend
  1	50 °C, 2 min
  2	95 °C, 20 s
  3–42		95 °C, 3 s	60 °C, 30 s

• 109

  Perform a qPCR with the following cycling conditions:

• 110

  Once the qPCR is complete, calculate the candidate gene expression fold change relative to control using the ddCt method according to the instrument manufacturer’s protocol.

• 111

  Additional steps for combining candidate genes from knockout and activation screens using dead sgRNAs (dRNAs). dRNAs are sgRNAs with 14- or 15-nt spacer sequences, which are truncated versions of the standard sgRNAs with 20-nucleotide spacer sequences, that are still capable of binding DNA^75,76. dRNAs are considered catalytically ‘dead’ because they can guide wild-type Cas9 without inducing double-stranded breaks. Adding MS2 binding loops to the dRNA backbone allows for wild-type Cas9 to activate transcription without cleavage. To achieve simultaneous knockout and activation, repeat Steps 44–55 to generate a cell line that stably expresses wild-type Cas9 and MS2-p65-HSF1.

• 112

  Transduce the Cas9- and MS2-p65-HSF1-expressing cell line with a standard sgRNA for knocking out a candidate gene and a 14-nt dRNA with MS2 binding loops for activating a second candidate gene according to Steps 69–83.

• 113

  Verify the screening phenotype, indel percentage, and fold activation according to Steps 84–110.

Troubleshooting

Troubleshooting advice can be found in Table 6. To clarify potential points of confusion when performing genome-scale screens using CRISPR-Cas9, we have compiled a list of most-frequently asked questions from our web-based CRISPR forum (discuss.genome-engineering.org) (Box 6). (Fig. 4)