Reducing m⁶A level promotes cervical cancer cell proliferation

To uncover the important role of m⁶A in cervical cancer development, cell proliferation was analyzed in human cervical cancer cell line SiHa. The m⁶A methylation is regulated by adenosine methyltransferases and demethylases [7–11]. To reduce the m⁶A level, the adenosine methyltransferases (METTL3 and METTL14) were knocked down through two different shRNA. The knock-down efficiency was evaluated with qPCR (Figure 2A-2C, Supplementary Figure 3A). Knocking down both METTL3 and METTL14 promoted SiHa cell proliferation (Figure 2B, 2D). On the other hand, overexpressing adenosine demethylases (FTO and ALKBH5) also decreases m⁶A level. The FTO and ALKBH5 overexpression were validated by western blot (Figure ​(Figure2E,2E, Supplementary Figure 3B). And their overexpression significantly promoted cell proliferation (Figure ​(Figure2F).2F). Furthermore, the cell motility was also increased by knocking down METTL3 and METTL14 or overexpressing FTO and ALKBH5 (Supplementary Figure 4).

Open in a separate window

Figure 2

Reducing m⁶A level promoted cervical cancer cell proliferation

(A) METTL3 shRNA knocking-down efficiency was determined by qPCR in cervical cancer cell line SiHa. n = 3. ^* P<0.05. (B) Knocking down METTL3 promoted cell proliferation. n = 3. ^* P<0.05. (C) METTL14 shRNA knocking-down efficiency was determined by qPCR. n = 3. ^* P<0.05. (D) Knocking down METTL14 promoted cell proliferation. n = 3. ^* P<0.05. (E) Overexpressing FTO and ALKBH5 were validated via western blot. (F) Overexpressing FTO and ALKBH5 promoted cell proliferation. n = 3. ^* P<0.05.

Thus, reducing m⁶A level could promote cervical cancer cell proliferation, indicating that increasing m⁶A level might have anti-cancer effects in cervical cancer.

Cervical cancer cell proliferation could be suppressed by increasing m6A level

As the reduced m⁶A level was tightly associated with poor outcomes and reducing m⁶A in cervical cancer cell lines could promote cell proliferation, we wondering whether increasing m⁶A would have anti anti-cancer effects or not in cervical cancer. Indeed, increasing m⁶A through knocking down adenosine demethylases (FTO and ALKBH5) or overexpressing adenosine methyltransferases (METTL3 and METTL14) suppressed the cancer cell proliferation (Figure 3A-3F, Supplementary Figure 3C-3D). Furthermore, the cell motility was also decreased by knocking down FTO and ALKBH5 or overexpressing METTL3 and METTL14 (Supplementary Figure 5). These data demonstrated that increasing m⁶A might inhibit cervical cancer development.

Open in a separate window

Figure 3

Increasing m6A level suppressed cervical cancer cell proliferation

(A) FTO shRNA knocking-down efficiency was determined by qPCR in cervical cancer cell line SiHa. n = 3. ^* P<0.05. (B) Knocking down FTO suppressed cell proliferation. n = 3. ^* P<0.05. (C) ALKBH5 shRNA knocking-down efficiency was determined by qPCR. n = 3. ^* P<0.05. (D) Knocking down ALKBH5 suppressed cell proliferation. n = 3. ^* P<0.05. (E) Overexpressing METTL3 and METTL14 was validated via western blot. (F) Overexpressing METTL3 and METTL14 suppressed cell proliferation. n = 3. ^* P<0.05.

RNA extraction and m6A dot blot assay

Total RNA was extracted from tissues with Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. mRNA was prepared from total RNA using the Dynabeads mRNA purification kit (Ambion, catalog no. 61006). RNA samples were quantified using UV spectrophotometry, and equal amounts were mixed 1:1 with glyoxal loading dye (Ambion) and denatured for 20 min at 50°C. 500ng mRNAs were spotted onto a nylon membrane (GE Healthcare). RNA was UV crosslinked to the membrane, and the membranes were blocked for 1 hr in 5% nonfat dry milk in 0.1% PBST (0.1% Tween-20 in 1x PBS, pH 7.4) (Blocking Buffer). Anti-m⁶A antibody (Synaptic Systems; catalog no. 202003) was diluted 1:1000 in 0.1% PBST and incubated on the membranes for 1 hr (25°C) to overnight (4°C). Following extensive washing with 0.1% PBST, HRP-conjugated donkey anti-rabbit IgG (GE Healthcare) was diluted 1:2500 in Blocking Buffer and added to the membranes for 1 hr at 25°C. Membranes were washed again in 0.1% PBST and developed with enhanced chemiluminescence (ECL; GE Healthcare). The intensity of dot blot signal was quantified by ImageJ.

Gene mutation analysis

Genomic DNA was extracted from tissues with QIAamp DNA Blood Mini Kit (Qiagen) according to the manufacturer's instructions. Exons were amplified with high fidelity DNA polymerase (NEB) and sequenced with ABI 3730. Sequence deletion, truncation and missense mutations were characterized as gene mutation in the present study.

Real-time PCR

cDNA was prepared by using the iScript™ cDNA Synthesis kit (Bio-Rad, USA). PCR primers (Generay, Shanghai, China) used for RT-PCR were as follows: for METLL3, sense: 5′-TCCTGACTGACCTTCTTGCTC-3′ and anti-sense: 5′- TCAGCATCGGAA CCAGCAAAG-3′; METLL14, sense: 5′- GTTGGAACA TGGATAGCCGC -3′ and anti-sense: 5′-CAATGCTGTCGGCACTTTCA -3′; FTO, sense: 5′- AACACCAGGCTCTTTACGGTC -3′ and anti-sense: 5′- TGTCCGTTGTAGGATGAACCC -3′; ALKBH5, sense: 5′- ATGCACCCCGGTTGGAAAC -3′ and anti-sense: 5′- GACTTGCGCCAGTAGTTCTCA-3′;β-actin, sense: 5′-CCTGACTGACTACCTCATGAAG-3′ and anti-sense: 5′-GACGTAGCACAGCTTCTCCTTA-3′. RT-PCR amplification reaction was prepared with the SYBR Green PCR kit (Bio-rad, USA) and performed using the 7500 fast Real-Time PCR system (Applied Biosystems, USA). PCR products were verified by melting curve analysis. Relative mRNA levels of target genes were calculated by the 2^-ΔΔct method.

Western blotting

Total protein from cultured cells were lysed in RIPA buffer with protease inhibitor (Beyotime, Shanghai, China). The protein was quantified using a BCA assay kit (Beyotime, Shanghai, China). A total of 20 μg of total protein were separated by 10% SDS-PAGE, transferred onto polyvinylidene fluoride membranes, and then reacted with primary antibodies against METLL3, METLL14, FTO, ALKBH5 and β-actin (all from Abcam, Cambridge, UK). After being extensively washed with PBS containing 0.1 % Triton X-100, the membranes were incubated with alkaline phosphatase-conjugated goat anti-rabbit antibody for 30 min at room temperature. The bands were visualized using 1-step TM NBT/BCIP reagents (Thermo Fisher Scientific, Rockford, IL, USA) and detected by an Alpha Imager (Alpha Innotech, San Leandro, CA, USA).

Cell culture

The cervical cancer cell lines SiHa was obtained from the American Type Culture Collection (ATCC; Rockville, MD, USA) and cultured in DMEM (GIBCO, Shanghai, China) supplemented with 10 % FBS.

Plasmid DNA and virus preparation

shRNAs were cloned into lentiviral pLKO.1-puro vector. The following shRNA sequences were used: control shRNA, 5`-ACTCAAAAGGAAGTG ACAAGA-30; METTL3 shRNA-1, 50-GCTGCACTTCAGACG AATT-30; METTL3 shRNA-2, 5`-CCACCTCAGTGGATC TGTT-3`; METTL14 shRNA-1, 5`-GCTAAAGGATGAG TTAAT-3`; METTL14 shRNA-2, 5`-GGACTTGGGATG ATATTAT- 3`; FTO shRNA-1, 5`-GGAAGATTTAAACT CCATGAAG-3`; FTO shRNA-2, 5`-CAAAGTGTTCAA TGGATGCAAC-3`; ALKBH5 shRNA-1, 5`-AGGTTCTC ATATTCTTGGTATC-3`; ALKBH5 shRNA-2, 5`-GATGAAATCACTCACTGCATAC-3`. The METTL3, METTL14, FTO and ALKBH5 expressing lentiviral vector was prepared by cloning the human full coding sequences into the pLVX-puro lentiviral vector.

Lentiviruses were prepared using 293T cells according to the manufacturer's instructions. Cells were incubated with lentivirus and 4 mg/mL polybrene (AmericanBio) for 24 hr.

Cell growth assay

Cells were seeded at 5×10⁴ cells per well in 24-well plates and cultured for 3 days. Cell number was counted using a hemocytometer.

Animal study

6–8 weeks old NOD/SCID mice (Charles River Laboratories, Beijing, China) were housed in specific pathogen-free conditions. The study was approved by the Research Ethics Committee of Shandong University. Mice were housed in the pathogen free region and monitored daily during the experiments and the mice would be sacrificed when the weight loss is more than 20%. For evaluation of the tumor growth in vivo, 5 × 10⁶ cells were suspended in 200 μl PBS and injected subcutaneously into the dorsal scapula region of the mice. For FTO Inhibitor MA2 treatment, the mice were treated with MA2 (5 nmol in 100μL PBS) or vehicle control by intratumoral injection once a week for 4 weeks. Tumor size was measured with fine digital calipers and calculated by the following formula: tumor volume =0.5 × width² × length. For imaging the tumor clearance in vivo, cells were transduced with a lentiviral construct that drives the expression of the click beetle red luciferase (CBR). Bioluminescence imaging was performed 4 weeks after injection. For imaging, mice were injected i.p. with D-luciferin (150 μg/g body weight), anesthetized (2% isoflurane), and placed in an IVIS 50 imaging system (Xenogen). Regions of interest (ROI) were defined manually over the whole body with Living-Image software (Igor Wavemetrics) for determining tumor burden signal intensities.