Reagents and antibodies

LPS (Escherichia coli serotype 055:B5), papaverine, H89, and antibodies against BDNF, iNOS, and β-actin were obtained from Sigma-Aldrich (St Louis, MO, USA). MPTP was purchased from Tokyo Chemical Industry Co. (Tokyo, Japan). Antibodies against phosphorylated and total Akt, MAPKs, and CREB were purchased from Cell Signaling Technology (Beverley, CA, USA). An antibody against phospho-p47phox was purchased from Assaybiotech (Sunnyvale, CA, USA). Antibodies against TNF-α, IL-1β, CD11b, lamin A, PDE10, and TH were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies against IL-10, Bcl2, PGC-1α, and GDNF were purchased from Abcam (Cambridge, UK). An antibody against Iba-1 was purchased from Wako (Osaka, Japan). All RT-PCR enzymes and chemicals and electrophoretic mobility shift assay (EMSA) oligonucleotides were purchased from Promega (Madison, WI, USA). All other chemicals were obtained from Sigma-Aldrich, unless otherwise stated.

Microglial cell culture and cell viability test

The immortalized mouse BV2 microglial cell line [35] was grown and maintained in Dulbecco’s modified Eagle medium supplemented with 10% heat-inactivated fetal bovine serum, streptomycin (10μg/mL), and penicillin (10U/mL) at 37°C under 5% CO₂. Primary microglial cells were cultured from the cerebral cortices of 1- to 2-day-old Sprague-Dawley rat pups as described previously [36]. The purity of the microglial cultures was > 95%, as confirmed by Western blot and immunocytochemistry analyses using an antibody specific to ionized calcium binding adapter protein-1 (Iba-1; data not shown). Cell viability was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) reduction assay, as previously described [37].

Measurement of cytokine, nitrite, intracellular ROS, and cAMP levels in BV2 cells

BV2 cells (1 × 10⁵ cells per well in a 24-well plate) were pretreated with PAP 1h prior to LPS stimulation (100ng/mL) for 16h. The supernatants of the cultured cells were collected and the concentrations of TNF-α, IL-1β, and IL-10 were measured by an enzyme-linked immunosorbent assay (ELISA) with a kit supplied from BD Biosciences (San Jose, CA, USA). Accumulated nitrite levels were measured using Griess reagent (Promega, Madison, WI). The intracellular accumulation of ROS was measured with H₂DCF-DA (Sigma-Aldrich, St. Louis, MO), as previously described [38]. To determine the effect of PAP on intracellular cAMP level, BV2 cells were treated with PAP with or without LPS stimulation for 30min, and cAMP level was measured using a cAMP ELISA kit from Enzo Life Sciences (Farmingdale, NY, USA).

Reverse-transcription polymerase chain reaction

Total RNA from BV2 cells and mouse brain tissue was extracted using TRIzol reagent (Invitrogen, CA, USA). For RT-PCR, 1μg RNA was reverse transcribed in a reaction mixture containing 1U RNase inhibitor, 500ng random primer, 3mM MgCl₂, 0.5mM dNTP, 1X RT buffer, and 10U reverse transcriptase (Promega, Madison, WI). The synthesized cDNA was used as a template for the PCR reaction using Go Taq polymerase (Promega) and primers for target genes. RT-PCR was carried out in a Bio-Rad T100 thermal cycler (Bio-Rad, Richmond, CA). Quantitative RT-PCR was performed on an ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) with Sensi FAST™ SYBR Hi-ROX Mix (Bioline, London, UK). The expression levels of the target genes were normalized against that of GADPH using the following formula: 2^{(Ct, test gene - Ct, GAPDH)}. The primer sequences used in the PCR reactions are shown in Table ​Table11.

Table 1

Primer sequences used for PCR

Gene	Forward primer (5′→3′)	Reverse primer (5′→3′)	Size
TNF-α	CCTATGTCTCAGCCTCTTCT	CCTGGTATGAGATAGCAAAT	354bp
iNOS	CAAGAGTTTGACCAGAGGACC	TGGAACCACTCGTACTTGGGA	450bp
IL-1β	GGCAACTGTTCCTGAACTCAACTG	CCATTGAGGTGGAGAGCTTTCAGC	447bp
IL-6	CACGATTTCCCAGAGAACATGTG	ACAACCACGGCCTTCCCTACTT	128bp
IL-10	GCCAGTACAGCCGGGAAGACAATA	GCCTTGTAGACACCTTGGTCTT	409bp
MMP-3	ATTCAGTCCCTCTATGGA	CTCCAGTATTTGTCCTCTAC	375bp
MMP-8	CCAAGGAGTGTCCAAGCCAT	CCTGCAGGAAAACTGCATCG	180bp
p47phox	CGATGGATTGTCCTTTGTGC	ATCACCGGCTATTTCCCATC	256bp
p67phox	CCCTTGGTGGAAGTCCAAAT	ATCCTGGATTCCCATCTCCA	242bp
gp91phox	ACTGCGGAGAGTTTGGAAGA	GGTGATGACCACCTTTTGCT	201bp
p22phox	AAAGAGGAAAAAGGGGTCCA	TAGGCTCAATGGGAGTCCAC	239bp
TLR2	GAGCGAGCTGGGTAAAGTAG	AGCCGAGGCAAGAACAAAGA	528bp
TLR4	GAGATGAATACCTCCTTAGTGTTGG	ATTCAAAGATACACCAACGGCTCTGA	414bp
GAPDH	TTCACCACCATGGAGAAGGC	GGCATGGACTGTGGTCATGA	245bp

Open in a separate window

Electrophoretic mobility shift assay

BV2 cells were pretreated with PAP for 1h and stimulated with LPS for 3h. The nuclear extracts from the cells were prepared as previously described [36]. Double-stranded DNA oligonucleotides containing the NF-κB, AP-1, ARE, and CRE consensus sequences were end labeled using T4 polynucleotide kinase (New England Biolabs, Beverly, MA) in the presence of [γ-³²P]ATP. Nuclear proteins (5μg) were then incubated with a ³²P-labeled probe on ice for 30min, resolved on a 5 % acrylamide gel, and visualized by autoradiography.

Western blot analysis

Whole cell protein lysates and brain tissue homogenates were prepared in a lysis buffer (10mM Tris (pH7.4), 30mM NaCl, 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate, and 1mM EDTA) containing a protease inhibitor cocktail. Protein samples were separated by SDS-PAGE, transferred to a nitrocellulose membrane, and incubated with primary antibodies according to the manufactures’ directions for dilution (Additional file 1: Table S1). After thoroughly washing with TBST, HRP-conjugated secondary antibodies (BioRad, Hercules, CA, USA 1:1000 dilution in TBST) were applied, and the blots were developed using an enhanced chemiluminescence detection kit (Thermo Fisher Scientific, Waltham, MA, USA). For quantification, the density of specific target bands was normalized against β-actin, using ImageJ software, version 1.37 (National Institutes of Health, Bethesda, MD).

Transient transfection and luciferase assay

BV2 cells (2 × 10⁵ cells/well on a 12-well plate) were transfected with 1μg of reported plasmid DNA using Metafectene transfection reagent (Biontex, Martinsried/Planegg, Germany). The effect of PAP on reporter gene activity was determined by pre-treating the cells with PAP prior to stimulation with LPS (100ng/mL) for 6h. After preparing the cell lysates, the luciferase assay was performed as previously described [36].

Drug administration

ICR mice were randomly divided into six groups (control, LPS, LPS+PAP, LPS+PAP+H89, PAP, and H89; each group, n = 8–10). H89 (1mg/kg, i.p.) was administrated 1h before PAP (30mg/kg/day, i.p.) for four consecutive days. A single injection of LPS (5mg/kg, i.p.) was administered 1h after the final PAP administration as previously described [36]. For studying the MPTP mouse model, C57/BL6 mice were divided into six groups (control, MPTP, MPTP+PAP, MPTP+PAP+H89, PAP, and H89; each group, n = 12–14). H89 (1mg/kg, i.p.) was administrated 1h before PAP (30mg/kg/day, i.p.) for three consecutive days. One day after the final PAP treatment, MPTP (20mg/kg, i.p) was injected four times with 2-h intervals [39].

Behavioral test

To assess mouse motor coordination, the rotarod test (20–21rpm, 600s), modified from a previous method [40], was performed 1, 3, and 7days after MPTP injection. Before the principal test, all mice were trained on the rotarod (18–19rpm) until no fall was observed in 300s. To evaluate dyskinesia, the pole test (50cm in height, 0.7cm in diameter, 120s) was implemented 6days after MPTP injection. Similarly, prior to the principal test, mice were trained three times to successfully descend from the top to the bottom of the pole.

Brain tissue preparation

For histological analysis, the mice were anesthetized with sodium pentobarbital (80mg/kg body weight, i.p. injection) and were then transcardially perfused with 0.9% saline followed by 4% paraformaldehyde for tissue fixation. The brains were then isolated and stored in 30% sucrose solution at 4°C for cryoprotection. For biochemical analysis, the mice were transcardially perfused with saline. The striatum and substantia nigra were dissected from each brain according to the Paxinos mouse brain atlas, and immediately frozen in liquid nitrogen until use.

Immunohistochemistry and immunofluorescence analysis

Using a cryotome (CM1860; Leica, Mannheim, Germany), 40-μm-thick coronal sections were cut, and were then stored in anti-freezing solution (30% ethylene glycol and 30% glycerol in phosphate-buffered saline) at − 20°C. For immunohistochemical (IHC) staining, sections were treated with 3% H₂O₂ and 4% BSA to inactivate endogenous peroxidation and block non-specific binding, respectively. Sections were incubated with primary antibodies overnight and incubated with biotinylated secondary antibodies for 1h at 25°C room temperature, followed by an avidin-biotin-HRP complex reagent solution (Vector Laboratories, Burlingame, CA, USA). Subsequently, the peroxidase reaction was performed using diaminobenzidine tetrahydrochloride (Vector Laboratories). For double immunofluorescence (IF) staining, sections were treated to block non-specific binding and were incubated with primary antibodies, followed by secondary antibodies conjugated to a fluorochrome. Detailed information on the primary antibodies used is presented in Additional file 1: Table S2. Digital images of the IHC and IF staining were captured using a Leica DM750 microscope and quantification was performed using Image J. For histological quantification, every fifth 40-μm-thick section from the region between bregma − 2.69mm and − 3.15mm (Paxinos mouse brain atlas) was analyzed. Four to six sections per brain were stained and quantified. The number of target protein-positive cells per area (mm²) was counted, and the co-localization rate (%) was calculated using the following formula: {(the number of target protein-positive cells co-stained with cell type marker)/the number of cell type marker-positive cells} × 100.

PAP inhibits the phosphorylation of MAPKs and Akt, and the activities of NF-kB and AP-1 in LPS-stimulated BV2 microglial cells

We also examined the effect of PAP on MAPKs and the PI3K/Akt signaling pathway, known to play an important role in proinflammatory gene expression by modulating transcription factors such as NF-κB and AP-1 [41, 42]. PAP inhibited LPS-induced phosphorylation of MAPKs and Akt in BV2 cells (Fig. ​(Fig.2a).2a). The DNA binding activity and reporter gene activity of both NF-κB and AP-1 were also inhibited by PAP in LPS-stimulated BV2 cells (Fig. ​(Fig.2b,2b, c), suggesting that PAP regulates inflammatory responses partly by modulating PI3K/Akt, MAPKs, NF-κB, and AP-1 signaling pathways.

Open in a separate window

Fig. 2

Effect of PAP on MAPKs, Akt, and NF-κB/AP-1 activities in LPS-stimulated BV2 cells. a Cell lysates were prepared from BV2 cells treated with LPS for 30min in the absence or presence of PAP, and Western blotting was performed to determine the effect of PAP on MAPKs and Akt activity. Quantification data are shown in the right panels (n = 3). Levels of the phosphorylated forms of MAPKs and Akt were normalized to the total forms and expressed as fold changes vs. untreated control samples, which were arbitrarily set to 1. b EMSA for NF-κB and AP-1 was performed using nuclear extracts prepared from BV2 cells treated with PAP in the presence of LPS for 3h. c Transient transfection analysis of [κB]₃-luc, and AP-1-luc reporter gene activity. Data are shown as the mean ± SEM of three independent experiments. ^#p < 0.05 vs. LPS-treated samples

PAP inhibits ROS production by suppressing the mRNA expression and phosphorylation of p47phox, a component of NADPH oxidases, and enhancing the Nrf2/ARE signaling pathway

Reactive oxygen species (ROS) are known to be early signaling inducers in inflammatory responses [43]. Thus, we investigated the effect of PAP on ROS production in LPS-stimulated BV2 cells. DCF-DA assay data showed that PAP inhibited the production of intracellular ROS induced by LPS (Fig. ​(Fig.3a).3a). Since NADPH oxidases are major enzymes involved in ROS generation, we investigated whether PAP influences the components of these enzymes. As shown in Fig. ​Fig.3b,3b, PAP suppressed the mRNA expression of p47phox, but not other components, in LPS-stimulated BV2 cells. In addition, PAP inhibited LPS-induced phosphorylation of p47phox (Fig. ​(Fig.3c).3c). Next, we examined the effect of PAP on antioxidant Nrf2/ARE signaling. EMSA data showed that PAP enhanced LPS-induced Nrf2 binding to ARE (Fig. ​(Fig.3d).3d). Moreover, PAP induced ARE-driven luciferase activity in the absence and presence of LPS (Fig. ​(Fig.33e).

Open in a separate window

Fig. 3

PAP reduced ROS production via suppression of a NADPH oxidase subunit and upregulation of Nrf2/ARE signaling. a BV2 cells were treated with PAP 1h prior to LPS stimulation for 16h, and intracellular ROS level was measured by the DCF-DA method. b RT-PCR to assess mRNA expression of NADPH oxidase subunits (p47^phox, gp91^phox, p67^phox, and p22^phox) in BV2 cells. c Western blot analysis to assess phosphorylation of the p47^phox subunit. BV2 cells were treated with PAP 1h followed by LPS (100ng/mL, 30min) and then subjected to immunoblot analysis using antibodies against phospho-p47^phox. d EMSA to assess Nrf2 DNA binding activity. e Transient transfection analysis of ARE-luc reporter gene activity. Data are shown as the mean ± SEM of three independent experiments. *p < 0.05 vs. control group; ^#p < 0.05 vs. LPS-treated group

The PKA/CREB pathway plays a crucial role in the anti-inflammatory effect of PAP

We investigated whether PAP affects intracellular cAMP level by modulating PDE. As expected, PAP increased cAMP level in BV2 cells in the presence and absence of LPS (Fig. ​(Fig.4a).4a). PAP also increased CREB phosphorylation (Fig. ​(Fig.4b)4b) and other CREB activities such as DNA binding, transcriptional activity, and nuclear translocation (Fig. ​(Fig.4c–e).4c–e). To determine whether the PKA/CREB pathway is involved in the anti-inflammatory mechanism of PAP, BV2 cells were pre-treated with a PKA inhibitor, H89, before PAP and LPS stimulation. The data showed that H89 significantly attenuated PAP-mediated suppression of NO, TNF-α, IL-1β, and ROS and attenuated PAP-induced IL-10 production (Fig. ​(Fig.4f).4f). Overall, these results indicate that the PKA pathway plays a pivotal role in the anti-inflammatory/antioxidant mechanisms of PAP.

Open in a separate window

Fig. 4

PAP enhanced PKA/CREB signaling, and H89 reversed the anti-inflammatory effects of PAP in LPS-stimulated BV2 cells. a Intracellular cAMP level was measured in BV2 cells treated with PAP in the presence or absence of LPS for 30min. b Western blot analysis to assess the phosphorylated and total forms of CREB using the same cell lysates as a. c EMSA to assess CREB DNA binding activity. d Transient transfection analysis of CRE-luc reporter gene activity. e Western blot to detect the nuclear translocation of CREB. f Cells were pretreated with H89 for 30min, then treated with PAP for 1h followed by LPS for 16h. The production of NO, TNF-α, IL-1β, IL-10, and ROS was measured. Data are shown as the mean ± SEM of three independent experiments. *p < 0.05, control vs. LPS-treated group; ^#p < 0.05, LPS vs. LPS+PAP-treated group; ^##p < 0.05, LPS+PAP vs. LPS+PAP+H89 group

PAP increases PPARγ and Nrf2/ARE signaling, in which PKA is an upstream modulator

Next, we examined the effect of PAP on PPARγ, a key transcription factor for the resolution of inflammation [44]. PAP increased the transcriptional activity of PPARγ, as shown by the cell-based reporter gene assay in BV2 cells (Fig. ​(Fig.5a).5a). To determine whether PPARγ has an effect on the anti-inflammatory role of PAP, a siRNA knockdown experiment was performed. Data from the PPARγ siRNA transfection showed that the anti-inflammatory effect of PAP is partially reversed by PPARγ knockdown (Fig. ​(Fig.5b),5b), suggesting that PPARγ plays an important role in the action of PAP. To investigate whether the upregulation of PPARγ is related to PKA signaling, BV2 cells were treated with H89 before LPS/PAP treatment and a PPRE-luc reporter gene assay was performed. As shown in Fig. ​Fig.5c,5c, H89 attenuated the effect of PAP on PPRE-luc activity. Moreover, H89 reversed the effect of PAP on ARE-luc activity (Fig. ​(Fig.5d).5d). These data suggest that PKA plays a role as an upstream modulator of PPARγ and Nrf2/ARE signaling in LPS/PAP-treated BV2 cells.

Open in a separate window

Fig. 5

PAP increased PPARγ activity, which also depends on PKA signaling. a Transient transfection analysis of PPRE-luc reporter gene activity. b BV2 cells were transfected with PPAR-γ-specific or control siRNA, and treated with LPS in the absence or presence of PAP (30μM) for 16h. Then, the production of NO, ROS, and cytokines was measured. ^#p < 0.05 vs. LPS-treated samples; ^##p < 0.05 vs. control siRNA-transfected cells in the presence of LPS+PAP. c, d BV2 cells transfected with the reporter plasmid (ARE-luc, and PPRE-luc) were pretreated with H89 for 30min. They were then treated by PAP for 1h followed by LPS for 6h. A luciferase assay was performed to measure the reporter gene activities of PPRE (c) and ARE (d). Data are shown as the mean ± SEM of three independent experiments. *p < 0.05, control vs. LPS-treated group; ^#p < 0.05, LPS vs. LPS+PAP-treated group; ^##p < 0.05, LPS+PAP vs. LPS+PAP+H89 group

PAP inhibits microglial activation and proinflammatory gene expression, which is reversed by the PKA inhibitor H89, in the brains of LPS-injected mice

To verify the effects of PAP in vivo, PAP was injected into mice prior to LPS administration. After 3days of LPS injection, microglial activation and the expression of proinflammatory molecules were evaluated in LPS-injected mouse brains. Systemic LPS increased the number of Iba-1-positive cells in the cortex, hippocampus, and substantia nigra. PAP decreased the number of these cells, indicating that this suppressed microglial activation (Fig. ​(Fig.6a,6a, b). Moreover, PAP suppressed the mRNA expression of iNOS, proinflammatory cytokines, matrix metalloproteinases (MMPs; MMP-3, MMP-8), and toll-like receptors (TLRs; TLR2, TLR4) and increased the expression of the anti-inflammatory cytokine IL-10 in LPS-injected mouse brains (Fig. ​(Fig.6c,6c, d). Next, to investigate whether PKA signaling is also involved in the anti-inflammatory effect of PAP in vivo, H89 was injected 1h before every PAP injection. As shown in Fig. ​Fig.66 a and e, H89 treatment reversed the PAP-mediated suppression of microglial activation and iNOS, TNF-α, and IL-1β expression. These results indicate that the PKA pathway is also involved in the anti-inflammatory action of PAP in LPS-injected mouse brains.

Open in a separate window

Fig. 6

Effects of PAP on microglial activation and the mRNA expression of inflammatory markers in the brains of LPS-injected mice. a, b Immunohistochemical staining for Iba-1 and quantification of the number of Iba-1-positive microglia 3days after LPS injection (each group n = 4–5). Microglial activation in the cortex, hippocampus, and substantia nigra of LPS-injected mice was reduced by PAP (30mg/kg), and this was reversed by H89 treatment. Representative images (a) and the quantification of data (b) are shown. Scale bars, 100μm. c, d Effects of PAP on the mRNA levels of iNOS, cytokines, microglial activation markers (TLR2, TLR4), and proinflammatory MMPs (MMP-3, MMP-8) in the cortices of LPS-injected mice (each group n = 4). Representative gels (c) and quantification data (d) are shown. e, f Effect of H89 on PAP-mediated suppression of proinflammatory gene expression in LPS-injected mouse brains. *p < 0.05, control vs. LPS-treated group; ^#p < 0.05, LPS vs. LPS+PAP-treated group; ^##p < 0.05, LPS+PAP vs. LPS+PAP+H89 group

PAP exerts anti-inflammatory and neuroprotective effects in MPTP-induced PD model mice

We investigated whether PAP has anti-inflammatory and neuroprotective effects in MPTP-induced PD model mice. An injection of PAP was administered once a day for 3days before MPTP injection, and mice were sacrificed 7days later for analysis to be conducted. Dopaminergic neuronal cell death was measured by tyrosine hydroxylase (TH) staining. The data showed that PAP recovered MPTP-mediated neuronal cell death in the substantia nigra and striatum (Fig. ​(Fig.7a;7a; SN, F_{3, 12} = 49.25, p < 0.01; striatum, F_{3, 12} = 49.24, p < 0.01). Moreover, PAP exerted anti-inflammatory effects by reducing MPTP-induced microglial activation (Fig. ​(Fig.7b;7b; F_{3, 12} = 9.33, p < 0.01), and the mRNA levels of proinflammatory cytokines and enhancing the mRNA level of the anti-inflammatory cytokine IL-10 (Fig. ​(Fig.7)c.7)c. Representative high-magnification images of microglia are shown in Additional file 2: Figure S2.

Open in a separate window

Fig. 7

Effect of PAP on dopaminergic neuronal cell death, microglial activation, and the expression of inflammatory genes in the brains of MPTP-injected mice. a Representative images of TH-positive neuronal cells in the substantia nigra and striatum (each group n = 4–5). Quantitative analysis was performed by measuring the number of TH-positive cells in the substantia nigra, and the optical density of TH-positive fibers in the striatum (right panel). b Representative images of Iba-1-positive microglial cells in the substantia nigra (each group n = 4–5). c Real-time PCR analysis was performed to examine the expression of iNOS and cytokines in the substantia nigra (each group n = 4). *p < 0.05 vs. control group; ^#p < 0.05 vs. MPTP group

Not applicable