Associated Data

Supplementary Materials

2.

NIHMS1636726-supplement-2.pdf (8.7M)

Data Availability Statement

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Mice.

BALB/cByJ (WT) and all the following strains, except where indicated, were obtained from or rederived at the JAX lab. C.129X1-Il4ra^tm3.1Tch (Il4ra^F709) have been previously described (Noval Rivas et al., 2013; Tachdjian et al., 2010). Tgfb1^tm2.1Doe/J, NOD/ShiLt-Tg(Foxp3-^EGFPcre)1cJbs/J (Foxp3^EGFPcre), B6.129X1-Gt(ROSA)26Sor^tm1(EYFP)Cos/J (R26^YFP/YFP) and B6.129(Cg)-Foxp3tm4(YFP/icre)Ayr/J (Foxp3^YFPcre) were backcrossed 12 generations on BALB/cBYJ (Azhar et al., 2009; Rubtsov et al., 2008; Srinivas et al., 2001; Zhou et al., 2008). C.129P2(Cg)-Il4-Il13^tm1.1Lky (Il4-Il13^fl/fl) mice were crossed with Il4ra^F709Foxp3^YFPcre mice as indicated (Noval Rivas et al., 2015; Voehringer et al., 2009). C.129S2-Stat6^tm1Gru (Stat6^−/−) mice were crossed with Il4ra^F709Foxp3^YFPcre mice (Kaplan et al., 1996). FVB/N-Tg(CAG-EGFP,TGFB1*)C8Kul/J (Tgfb1^Tg) mice were backcrossed on C57BL/6 for 6 generations (Hall et al., 2010). DO11.10Foxp3^EGFPcre were generated from the respective transgenic mice (Murphy et al., 1990). B6.Tg(Mcpt5^cre) and B6.Foxp3^YFPcre mice were interbred with B6;129-Tgfbr2^tm1Karl/J mice to create Mcpt5^creTgfbr2^Δ/Δ and Foxp3^YFPcreTgfbr2^Δ/Δ mice, respectively (Burton et al., 2014; Scholten et al., 2008). Mice were maintained under specific pathogen-free conditions and used according to the guidelines of the institutional Animal Research Committee at the Boston Children’s Hospital.

Human study population.

Three groups of subjects, aged from 6 months to 20 years were recruited under a protocol approved by the Institutional Review Board at the Boston Children’s Hospital: 1) healthy subjects without a history of FA or atopy (n=6), 2) non-food allergic subjects with other atopic diseases (including asthma, atopic dermatitis and allergic rhinitis) (n=27) and 3) subjects who have FA (n=22), as determined by the World Allergy Organization diagnostic criteria (2010). Subject demographics and allergen reactivity are detailed in Table S1, and inclusion and exclusion criteria are detailed as previously described (Abdel-Gadir et al., 2019).

METHOD DETAILS

Sensitization and challenge protocol.

Mice were treated intragastrically with either sterile PBS or OVA (Sigma-Aldrich) (250μg) together with 10μg SEB (Toxin Technology) in PBS (Treg) once weekly for 8 weeks (Abdel-Gadir et al., 2019). On week 9, mice were challenged intragastrically with 150 mg of OVA. Anaphylaxis was assessed by measuring changes in total body core temperature with transponders placed subcutaneously 2 days before challenge (IPTT-300; Bio Medic Data Systems) and a DAS-6001 console (Bio Medic Data Systems).

ATAC-Seq.

20,000 Treg cells/sample were used for preparation of ATAC-seq libraries according to the protocol described previously; however, with few modifications (Buenrostro et al., 2015). Briefly, cells were suspended in 100μl of cold hypotonic lysis buffer [10mM Tris-HCl (pH 7.5), 10mM NaCl, 3mM MgCl2 and 0.5% NP40], followed by immediate centrifugation at 550g for 30 min and re-suspension of the pellet in 5μl of transposition reaction mix [1μl of Tagment DNA Enzyme and 2.5μL of Tagment DNA Buffer from Nextera DNA Sample Prep Kit (Illumina), 1.5μl H₂O]. The transposition reaction was incubated for 60 min at 37°C which led to fragmentation and tagging of DNA. For library preparation, 7-cycles of PCR were performed followed by selection of small fragments (less than 600bp) using SPRI beads. A second round of PCR (7-cycles) with similar conditions was performed in order to obtain the final library. Libraries were sequenced on the NextSeq 500 instrument to generate paired-end short reads (50bp, forward; 33bp, reverse). Paired-end sequencing reads were aligned to the mouse reference genome (mm10) using bowtie aligner version 2.2.9 (Langmead and Salzberg, 2012), followed by removal of reads with multiple alignments as well as reads mapping to mitochondrial DNA. De-duplication of reads was performed with picard (v2.8.0). makeTagDirectory command of Homer package (v4.9) was used to create the tag directory followed by identification of peaks using the ‘factor’ parameter in the find Peaks command (Heinz et al., 2010). For visualization of ATAC-seq data, replicate specific bam output files from picard were merged and converted into normalized bigwig format using the bamCoverage function in deepTools with options - fragmentLength 200 -normalizeUsingRPKM (Ramirez et al., 2014), and bigwig file was visualized on Integrative Genomics Viewer (IGV) (Robinson et al., 2011).

Chromatin Immunoprecipitation.

Treg cells were sorted from either Foxp3^YFPcre or Foxp3^YFPcreIl4ra^F709 mice. The cells were then kept for 8 min in 1 ml of 1% paraformaldehyde (PFA; Sigma-Aldrich) at room temperature (RT). Next, the sample incubated with lysis buffer I (5mM PIPES pH 8, 85mM KCl, 0,5% NP40 (Igepal-CA630), Protease Inhibitor) for 20 min at RT, and then centrifuged for 5 min at 7,870 g at RT. The pellet was lysed with lysis buffer II (10mM Tris-HCl pH 7,5, 150mM NaCl, 1% NP40 (Igepal-CA630), 1% DOC (Natrium Deoxycholate), 0,1% SDS, 1mM EDTA, Protease Inhibitor). The chromatin was further sonicated to a length of 25–500 bp using bioruptor (Diagenode, USA) for 35 cycles (30 sec on, 30 sec off). The chromatin was then precipitated using either IgG mock control, STAT6 (Cell Signaling Technology), H3K4me3 (Active Motif, USA) or H3k27me3 (Active Motif USA) histone methylation overnight. The chromatin was washed twice with each of the different washing buffers [wash buffer I (20mM Tris-HCl pH 8, 150mM NaCl, 2mM EDTA, 0,1% SDS, 1% Triton X100), wash buffer II (20mM Tris-HCl pH 8, 500mM NaCl, 2mM EDTA, 0,1% SDS, 1% Triton X100) and wash buffer III (10mM Tris-HCl pH 8, 1% NP40 (Igepal-CA630) 1% DOC, 1mM EDTA, 0,25M LiCl)]. The chromatin was then cleaned using 1X TE buffer (10mM Tris-HCl pH 8, 1mM EDTA) and eluted using an elution buffer (1% SDS, 0,1M NaHCO3). The DNA was then cleaned using QIAquick PCR purification kit (Qiagen, USA). The DNA was then used in polymerase chain reaction (PCR) were conducted with the relevant primers (Harb et al., 2015). PCR primers for putative STAT6 binding in the Tgfb1 promoter are: Forward - TCCTTGACACTCTCATCCGC and Reverse - GGCACTGTCTTCATCTTAGCG. Percent enrichment to the input control was calculated for each target locus and separately for mock (IgG), STAT6, H3K4me1 or H3k27me3 antibodies. Intra- and inter-assay coefficients of variation calculated for percent enrichment did not exceed 10%. All samples were processed according to the same standardized protocol and analyzed blinded and in a randomized order.

Plasmids and reagents:

pGL3-Tgfb1 was obtained from Addgene (Yeh et al., 2018). The mouse Tgfb1 promoter plasmid was generated using C57BL/6 cDNA using the following primers: mWTTgfb1-F: attaggtaccacatgagcagggcccactgt, mWTTgfb1-R: taataagcttgcgaagggcggcggcggcgg. The Tgfb1 promoter harboring a deletion of the STAT6 binding site was generated using the Q5 Site-Directed Mutagenesis Kit (NEB) and the following primer set: mMUTTgfb1-f: ACATGAGCAGGGCCCACTGTTAAAGCGTGT, and mMUTTgfb1-r: ACCCATGAGAAATACACGCTTTAACAGTGG. The sequences of both the native (Tgfb1^STAT6) and mutant (Tgfb1^ΔSTAT6) Tgfb1 promoter plasmids were confirmed by Sanger sequencing.

Luciferase assay:

EL4 cells were seeded in 6-well plates with non-antibiotic X-VIVO 15 medium and transfected with reporter gene plasmids as indicated. The total amount of DNA was kept constant. pTK-Renilla was co-transfected to normalize transfection efficiency. 24 hours (hr) post transfection, EL4 cells bearing the Tgfb1^STAT6 or Tgfb1^ΔSTAT6 plasmid constructs were stimulated with 20ng/ml of mouse IL-4 for 24 hr before luciferase reporter assays were performed. Luciferase activity was analyzed with the Dual Luciferase Reporter Assay System (Promega).

Isolation of Spleen, MLN and LP lymphocytes.

Spleen and MLNs were isolated and homogenized in PBS containing 2% FCS buffer. Red blood cells from splenic suspensions were lysed with ACK buffer. Cells were washed once with PBS containing 2% FCS and used for experiments. Small intestines were dissected from mice and the fecal contents were flushed out using PBS containing 2% FCS. Peyer’s patch was excised and the intestines were cut into 1cm pieces and treated with PBS containing 2% FCS, 1.5 mM DTT, and 10mM EDTA at 37 °C for 30 min with constant stirring to remove mucous and epithelial cells. The tissues were then minced and the cells were dissociated in RPMI containing collagenase (2 mg/ml collagenase II; Worthington), DNase I (100 μg/ml; Sigma-Aldrich), 5mM MgCl₂, 5mM CaCl₂, 5mM HEPES, and 10% FBS with constant stirring at 37 °C for 45 min. Leukocytes were collected at the interface of a 40%/70% Percoll gradient (GE Healthcare). The cells were washed with PBS containing 2% FCS and used for experiments.

Flow cytometry.

The following anti-mouse monoclonal antibodies (mAb) were used: CD3 (17A2), CD4 (RM4–5), IgE (RME-1), LAMP-1 (1D4B), CD86 (GL-1), CTLA-4 (UC10–4B9), ICOS (C398.4A), LAP (TW7–16B4), B220 (A3–6B2), cKit (2B8), IL-4 (11B11), IL-17a (TC11–18H10.1), IFN-γ (XMG1.2), Gr-1 (RB6–8C5), CD11b (M1/70), CD19 (6D5), I-Ad (39-10-8), CD45 (30-F11), and Ly-6C (HK1.4) were from Biolegend. Foxp3 (FJK-16S), GATA-3 (TWAJ), ROR-γt (BD2), Helios (22F6), IRF4 (3E4), Ki67 (SolA15), FcεR1a (MAR-1), CD11c (N418), CD4 (RM4–5), CXCR5 (SPRCl5), CD44 (IM7), CD62L (MEL-14), OX40 (OX86), GL-7 (GL-7), LAP (TW7–16B4), GARP (YGIC86), CD80 (16–10A1). CD25 (PC61.5), CD127 (A7R34), CD279 (J43) and cKit (2B8) were from eBiosciences. Anti-human mAb used in this study included CD3 (SK7), CD127 (A019D5), (Biolegend); CD4 (RPA-T4), LAP (TW4–6H10), FOXP3 (PCH101); CD25 (2A3), and ROR-γt (Q31–378) were from BD Biosciences; Cell viability dye (eFluor506) and (eF780) was from eBioscience. For cytokines cells were stimulated during 4 hours with PMA (50 ng/ml; Sigma-Aldrich) and ionomycin (500 ng/ml; Sigma-Aldrich) in the presence of Golgi Plug (BD Biosciences), then stained with the BD Cytofix/Cytoperm buffers (BD Biosciences) and the indicated anti-cytokine antibody. For intracellular staining of nuclear factors, the Foxp3 Transcription Factor buffer set (eBioscience) was used. Dead cells were routinely excluded from the analysis based on the staining of eFluor 506 fixable viability dye (eBioscience), and analyses were restricted to single cells using FSC-H and FSC-A signals. Stained cells were analyzed on an LSR Fortessa (BD Biosciences) and data were processed using Flowjo (Tree Star Inc.).

Quantitative real-time PCR for host immunological Targets.

RNA was extracted from cells using RNeasy Mini kit (Qiagen) according to the manufacturer protocol. Reverse transcription was performed with the SuperScript III RT-PCR system and random hexamer primers (Invitrogen) and quantitative real-time reverse transcription (RT)-PCR with Taqman® Fast Universal PCR master mix, internal housekeeping gene mouse (Gapdh FAM dye) and specific target gene primers for murine Tgfb1, Tgfb2, and Tgfb3, as indicated (FAM Dye) (Applied Biosystems) on Step-One-Plus machine. Relative expression was normalized to Gapdh and calculated as fold change compared to Foxp3^YFPcre Treg cells or Teff cells.

Bacterial consortia.

The composition and preparation of the Clostridiales and Proteobacteria consortia has been previously detailed (Abdel-Gadir et al., 2019).

ELISA.

Total, OVA-specific IgE and Murine mast cell protease 1 (MMCP-1) concentrations were measured in the sera of treated mice by ELISAs, as previously described (Abdel-Gadir et al., 2019).

TGF-β1 ELISA assays:

CD4⁺ T cells were enriched from mouse spleen by positive selection with anti-CD4 microbeads (Miltenyi Biotec). Enriched CD4⁺ T cells were further purified with a cell sorter by gating on YFP⁺CD4⁺ T cells for Treg cells and YFP⁻ CD4⁺ T cells for Teff cells. For monocyte purification, CD4 T cell-depleted splenocytes were stained with PE conjugated CD11b mAb, and the CD11b⁺ cells were enriched by positive selection of anti-PE microbeads (Miltenyi Biotec). Monocytes were further purified from the enriched CD11b⁺ cells with a cell sorter by gating on CD11b⁺Ly6C⁺ cells. B cells were sorted from CD4 and CD11b depleted splenocytes by gating on CD19⁺ cells. Sorted cells were cultured at 0.5 × 10⁶ cells/well (Treg and Teff cells) or at 1 × 10⁶ cells/well (B cells and monocytes) in X-VIVO 15 media. CD4⁺ T cells were activated in the presence of anti-CD3/CD28 dynabeads (Thermofisher) and 1μg/ml of IL-2 (eBioscience) for 48h. B cells were activated with 10μg/ml F(ab′)2 goat anti-mouse IgM antibodies (αIgM ; Jackson ImmunoResearch Laboratories) and 1μg/ml recombinant CD40 ligand (CD40L; eBioscience) for 48h. Monocytes were activated with 1μg/ml lipopolysaccharides (LPS; Sigma-Aldrich) for 48h. TGF-β1 cytokine amounts in the tissue-culture supernatant was detected using the TGF-β1 ELISA kit from R&D Systems (DY1679–05) according to the manufacturer’s protocol.

Histology.

Intestinal mast cells were counted by microscopic examination of jejunal sections fixed in 10% formaldehyde and stored in ethanol 70% before staining with toluidine blue by the Harvard Rodent Histopathology Facility.

Autoantibody array analysis.

Autoantibody-by-autoantibody antibody analyses between group for differential expression were conducted using the R package ‘limma’ and multiple comparisons correction was performed in R (Ritchie et al., 2015). An antibody was considered statistically differentially antibody only if the Benjamini Hochberg-adjusted p value < 0.05 between the tested groups and the mean of expression of mutant group is 2-fold increase over wild group. The statistically significant autoantibodies were used to generated heatmap by heatmap.2 in gplots R package

B cell depletion:

B cell depletion in 15 days old Foxp3^YFPcreTgfb1^Δ/Δ mice was performed by intraperitoneal injection of 200μg anti-CD20 (clone AISB12, BioXCell) or IgG2a isotype control (clone 2A3, BioXCell) mAb per mouse weekly until the end of the survival analysis.

Mast cell suppression assay:

Treg cells were purified from either Foxp3^YFPcre, Foxp3^YFPcreTgfb1^Δ/+ and Foxp3^YFPcreTgfb1^Δ/Δ. Mast cells were differentiated from bone marrow as previously described (Burton et al., 2013). Mast cells and Treg cells were dispensed 5X10⁴ cells per well, respectively in conic 96 well plates, with 5ng/ml of IgE SPE7 (Sigma-Aldrich), 3ng/ml of mouse IL-3 (eBioscience), and CD3/CD28 activation beads were added accordingly to the manufacturer instructions (eBioscience), for a final volume of 100μl of RPMI. In some conditions mast cells were plated without Treg cells in the same final volume of 100μl of RPMI. After an overnight incubation at 37°, cells were stimulated for 10 min at 37°with DNP-BSA to assess the degranulation status of mast cells. 10μl of the 10x stimulus mix (500ng/ml DNP/BSA (sigma-Aldrich), 1/100 anti-LAMP-1 APC (Biolegend), 1/100 anti-ckit PE (eBioscience), 1/100 anti-CD4 FITC (Biolegend) and 1/1000 fixable viability dye eFluor 780 (eBioscience) were added per well. The reaction was stopped by adding 100μl/well of cold PBS/BSA containing 2mM EDTA. the plate was centrifuged for 3min at 1400rpm, the supernatants were discarded and the cells were suspended in 200μl/well of cold PBS/BSA and 2mM EDTA. The plate was centrifuged again for 3min at 1400rpm. The cells were suspended in 200μl of cold PBS/BSA and 2mM EDTA and the flow cytometry was performed immediately before losing the degranulation effect.

Treg cells adoptive transfer.

EGFP⁺CD4⁺DO11.10⁺ Treg cells were cell sorted from Foxp3^EGFPcre and Foxp3^EGFPcreTgfb1^Δ/Δ mice, respectively. For treatment of established FA, Il4ra^F709 recipients were sensitized with OVA-SEB during 8 weeks. At week 9, the Treg-sensitized mice were given retro-orbitally at 5×10⁵ Treg cells of the respective genotype, sensitized with OVA-SEB for 4 more weeks and challenged at week 5 (150mg OVA). For FA prevention, CD4⁺ DO11.10⁺Foxp3^EGFP+ Treg cells were given retro-orbitally at 5×10⁵ cells/mouse on day 0 of the sensitization protocol. The mice were then sensitized with OVA-SEB for 8 weeks then challenged with OVA.

Quantification and Statistical Analysis.

All experiments were performed using randomly assigned mice without investigator blinding. Results of Anaphylaxis temperature curves were analyzed by using 2-way ANOVA. Student’s unpaired two tailed t test were used for 2 groups comparisons. For more than 2 groups, 1-way ANOVA with Tukey or Bonferroni post-test analysis using Prism 8 (GraphPad). Results are presented as means (horizontal lines or rectangular bars) and SEM where each point represents one sample. Differences in mean values were considered significant at a p < 0.05.

The cytokine TGFβ−1 is implicated in controlling allergic and autoimmune responses, However the specific role of regulatory T (Treg) cell-derived TGFβ−1 in governing these responses has been unclear. Turner et al demonstrate that Treg cell-derived TGF-β1 is critical in restraining allergic and autoimmune diseases in a gene dose-dependent manner.