Integration of Estrogen and Wnt Signaling Circuits by the Polycomb Group Protein EZH2 in Breast Cancer Cells^▿

Cell cultures and reagents.

MCF-7 and T47-D cells (American Type Culture Collection, Manassas, VA) were grown in phenol red-free Eagle's minimal essential medium (HyClone, Logan, UT) supplemented with 10% dextran-charcoal-stripped fetal bovine serum (FBS; HyClone). Cells from <50 passages were used for experiments. 17β-Estradiol (E2) was purchased from Sigma (St. Louis, MO). Polyclonal anti-EZH2 antibodies were obtained from Zymed Laboratories Inc. (San Francisco, CA). Polyclonal anti-estrogen receptor α (anti-ERα) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Monoclonal anti-c-Myc (9E10) antibody and monoclonal anti-cyclin D1 (A-12) antibody were obtained from Santa Cruz Biotechnology, and protein A-Sepharose CL-4B beads were from Amersham Biosciences. Protease inhibitor mixture cocktail was obtained from Roche Applied Science.

Transient transfection and reporter assays.

Cells were plated at a density of 1 × 10⁵ cells per cell in 24-well plates. After 24 h, cells were transfected with c-Myc promoter-driven luciferase constructs (16) (c-Myc-Luc) or cyclin D1 promoter-driven luciferase constructs (50) (cyclin D1-Luc) using Lipofectamine 2000 according to the manufacturer's instruction. Forty-eight hours after transfection, the cells were harvested. Firefly and Renilla luciferase activities were measured using a dual luciferase kit (Promega, Madison, WI). The firefly luciferase data for each sample were normalized based on transfection efficiency as measured by Renilla luciferase activity. Each experiment was performed in triplicate and repeated at least three times.

Real-time quantitative PCR.

The ABI Prism 7700 sequence detector and the TaqMan EZ reverse transcriptase PCR (RT-PCR) kit (Applied Biosystems, Foster City, CA) were used to quantitate gene expression, with glyceraldehyde-3-phosphate dehydrogenase as the internal control. The primers and probes used were as follows: c-Myc forward primer, GCCACGTCTCCACACATCAG; c-Myc reverse primer, TCTTGGCAGCAGGATAGTCCTT; c-Myc probe, 6-carboxyfluorescein-ACGCAGCGCCTCCCTCCACTC-6-carboxytetramethylrhodamine; cyclin D1 forward primer, CACGCGCAGACCTTCGTT; cyclin D1 reverse primer, GCGGATTGGAAATGAACTTCA; cyclin D1 probe, 6-carboxyfluorescein-CCTCTGTGCCACAGAT-6-carboxytetramethylrhodamine.

RNA interference.

A vector-based RNAi method was utilized. For initial experiments, three specific sequences corresponding to different regions of mRNAs were synthesized and tested for efficiency in knockdown of specific protein expression, and the sequence with an optimal efficiency was used in the experiment. Plasmids were constructed by inserting a synthesized 64-mer oligonucleotide containing the specific sequences for open reading frames of the genes into pSUPER or pSILENCER vectors (58). The sequences synthesized were as follows: EZH2 small interfering RNA (siRNA), forward, 5′-GATCCCGCTTCTGTGAGCTCATTGCGTTCAAGAGACGCAATGAGCTCACAGAAGTTTTTGGAAA-3′, and reverse, 5′-AGCTTTTCCAAAAACTTCTGTGAGCTCATTGCGTCTCTTGAACGCAATGAGCTCACAGAAGCGG-3′; β-catenin siRNA, forward, 5′-GATCCCCTGCTTGGTTCACCAGTGGATTCAAGAGATCCACTGGTGAACCAAGCATTTTTGGAAA-3′, and reverse, 5′-AGCTTTTCCAAAAATGCTTGGTTCACCAGTGGATCTCTTGAATCCACTGGTGAACCAAGCACGGG-3′; ERα siRNA, forward, 5′-GATCCCCGCTACTGTTTGCTCCTAACTTCAAGAGAGTTAGGAGCAAACAGTAGCTTTTTGGAAA-3′, and reverse, 5′-AGCTTTTCCAAAAAGCTACTGTTTGCTCCTAACTCTCTTGAAGTTAGGAGCAAACAGTAGCGGG-3′. The oligonucleotides were resuspended in annealing buffer (100 nM potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM acetate) and heated to 95°C for 4 min, 70°C for 10 min, and then cooled to room temperature to generate double-stranded DNA. The double-stranded DNA was then phosphorylated and cloned into the BglII/HindIII site of the pSUPER vector (pSUPER-EZH2) and the BamHI/HindIII site of the pSILENCER vector (pSILENCER-EZH2). The vectors were then transfected into MCF-7 cells with the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA).

GST pull-down experiments.

Glutathione S-transferase (GST) fusion constructs were expressed in BL21 Escherichia coli cells, and crude bacterial lysates were prepared by sonication in 50 mM Tris-HCl, pH 7.4, 1.5 mM EDTA, 1 mM dithiothreitol, 10% (vol/vol) glycerol, 0.4 M NaCl in the presence of the protease inhibitor mixture. The in vitro transcription and translation experiments were done with rabbit reticulocyte lysate (TNT systems; Promega, Madison, WI) and l-[³⁵S]methionine (Amersham Biosciences) according to the manufacturer's recommendation. In GST pull-down assays, about 10 μg of the appropriate GST fusion protein was mixed with 5 to 8 μl of the in vitro-transcribed/translated products and incubated in binding buffer (75 mM NaCl, 50 mM HEPES, pH 7.9) at room temperature for 30 min in the presence of the protease inhibitor mixture. The binding reaction mixture was then added to 30 μl of glutathione-Sepharose beads and mixed at 4°C for 2 h. The beads were washed three times with binding buffer, resuspended in 30 μl of 2× sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer, and resolved on 10% gels. The gels were then fixed in 50% methanol, 10% acetic acid for 30 min and dried. Protein bands were detected by autoradiography at −80°C for 4 to 24 h.

Coimmunoprecipitation assay and Western blotting.

MCF-7 cells were grown in dishes of 100-mm diameter seeded with 1 × 10⁶ cells. For immunoprecipitation experiments, cells were maintained in phenol red-free medium supplemented with 10% dextran-charcoal-stripped FBS for 72 h and then treated with 10 nM E2 or with vehicle (100% ethanol) for 2 h. Cells were washed twice with ice-cold phosphate-buffered saline (PBS) and then incubated in lysis buffer (50 mM Tris, pH 8.0, 120 mM NaCl, 0.5% [vol/vol] Nonidet P-40, and protease inhibitor mixture) for 10 min on ice. Cell extracts were collected using a rubber policeman and incubated with the anti-ERα and anti-EZH2 antibodies or control normal rabbit immunoglobulin G overnight 4°C on a rotator, followed by addition of protein A-Sepharose CL-4B beads for 2 h at 4°C. Beads were washed twice in NETN buffer I (20 mM Tris, pH 8.0, 1 mM EDTA, 900 mM NaCl, 0.5% [vol/vol] Nonidet P-40, and protease inhibitor mixture), and washed twice in NETN buffer II (20 mM Tris, pH 8.0, 1 mM EDTA, 900 mM NaCl, 0.5% [vol/vol] Nonidet P-40, and protease inhibitor mixture). Complexes were released from the protein A-Sepharose CL-4B by boiling for 5 min in 2× SDS-PAGE loading buffer. The immunoprecipitated materials were separated on 10% SDS-PAGE and blotted onto nitrocellulose membrane, and the membrane was probed using appropriate antibodies.

ChIP and re-ChIP assays.

Chromatin immunoprecipitation (ChIP) assays and re-ChIP were performed essentially the same as described previously (43-45, 60). The primers used were the following: for the c-Myc promoter, forward, 5′-CACAGGACAAGGATGCGGTT-3′, and reverse, 5′-CTTCTGCCTCTCGCTGGAAT-3′; for the MYT1 promoter, forward, 5′-GGGTGAATGTGGTGGTTGTG-3′, and reverse, 5′-TGGAGTCCTGTGTCCTGCTCT-3′. Quantitative ChIP was performed using Sybr Green (Molecular Probes, Eugene, OR) as a marker for DNA amplification on the ABI Prism 7700 sequence detector. The amounts of immunoprecipitated DNA were normalized to the input and are reported relative to the amount obtained at about bp −7000, which was set to 1. The bp −7000 site was used to normalize all the ChIP data in this study because it represented a negative control for transcription factor and coactivator binding.

Construction of EZH2 deletion mutants.

EZH2 deletion mutants were constructed via PCR with subsequent ligation of the N-terminal and C-terminal fragments. The PCR primers for creating deletion 1 were the following: N-terminal fragment, 5′ primer (CTCGGATCCATAATCATGGGC) and 3′ primer (TTCTCTATCCAAGTCACTGGTCACCGAACA); C-terminal fragment, 5′ primer (GATAGAGAATGTGGGTTTATAAATGAT) and 3′ primer (CATGCTCGAGGTTCCTGAAGC). The PCR primers for creating deletion 2 were as follows: N-terminal fragment, 5′ primer (CTCGGATCCATAATCATGGGC) and 3′ primer (CTTTGCTCCAGGTGGGCGGCTTTCTTTATC); C-terminal fragment, 5′ primer (GGAGCAAAGGAGTTTGCTGCT) and 3′ primer (CATGCTCGAGGTTCCTGAAGC). The PCR primers for creating deletion 3 were the following: N-terminal fragment, 5′ primer (CTCGGATCCATAATCATGGGC) and 3′ primer (CAATAGATGGTGTGCAGCCCACAACCG); C-terminal fragment, 5′ primer (CATCTATTGCTGGCACCATCTGAC) and 3′ primer (CATGCTCGAGGTTCCTGAAGC). The PCR primers for creating deletion 4 were the following: 5′ primer (CTCGGATCCATAATCATGGGC) and 3′ primer (TGCATGCTCGAGTCAGTCAGATGGTGCCAGCAATAGATG). The PCR primers for creating deletion 5 were 5′ primer (CTCGGATCCATAATCATGGGC) and 3′ primer (TGCATGCTCGAGTCAGTCAGATGGTGCCAGCAATAGATG). The resulting products were inserted into BamHI and XhoI sites of the pcDNA3.1(+) plasmid (Invitrogen, Carlsbad, CA).

Cell cycle analysis.

To prepare cells for fluorescence-activated cell sorter analysis, MCF-7 cells were transfected with empty vector and constructs containing EZH2 and EZH2 siRNA. Forty-eight hours after transfection, the cells were treated with ICI 182 780 for 12 h and were then switched to fresh medium and treated with E2 for different periods of time. The cells were then fixed in 70% ethanol overnight at −20°C. After washing with 1% bovine serum albumin-PBS, cells were incubated with 10 μl (10 mg/ml) of RNase A (Sigma) in PBS-0.25% Triton X-100 for 30 min at room temperature and then stained with 50 mg/ml propidium iodide in 50 mM sodium citrate for 20 min at room temperature in the dark. Cell cycle data were collected with a FACScan (BD Bio-Sciences Immunocytochemistry Systems) and analyzed with CELLQUEST software.

EZH2 enhanced the transactivation of c-Myc and cyclin D1 by estrogen and Wnt signaling pathways.

The role of estrogen in breast cancer carcinogenesis is well established (42). As stated above, recent investigations have found that EZH2 is also implicated in promoting the carcinogenesis and aggression of breast cancer (3, 20). In order to investigate whether there is any connection between estrogen signaling and EZH2 activity in breast cancer cells, we first examined what, if any, effects of EZH2 on the transactivation of ER target genes such as c-Myc (10) and cyclin D1 (32), both of which are known to play a crucial role in regulation of cell proliferation. For this purpose, we cotransfected the ER⁺ breast cancer cell line MCF-7 with a c-Myc promoter-driven luciferase reporter (c-Myc-Luc) or a cyclin D1 promoter-driven luciferase reporter (cyclin D1-Luc) and an EZH2 mammalian expression construct. The cells were then grown in the absence or presence of E2 for different periods of time, and the luciferase activity was measured. As shown in Fig. 1, in contrary to its established role as a transcription repressor, EZH2 drastically enhanced the expression of the reporter genes driven by the c-Myc promoter (Fig. 1A, upper panel) and by the cyclin D1 promoter (Fig. 1A, lower panel), and this effect was time dependent and EZH2 dose dependent. Furthermore, the enhancement activity of EZH2 is dependent on ERs, as the addition of the ER antagonist ICI 182 780 almost abolished the reporter activation (Fig. 1B). Similar results were obtained in another ER⁺ breast cancer line, T47-D, but not in an ER⁻ breast cancer cell line, MDA-MA 231 (data not shown), further supporting the dependence on ERs of EZH2 in facilitating estrogen downstream gene transactivation.

ERs regulate gene transcription through recruitment of coactivators that function to remodel the chromatin structure (28, 31, 42). Previously we showed that the p160 family of coactivators are both necessary and sufficient in transducing ER signaling (44). Therefore, it is reasonable to believe that EZH2 and the p160 proteins have an additive or synergistic enhancement effect on ER-regulated gene transcription. Indeed, we observed that cotransfection of EZH2 and SRC-1 induced a higher level of c-Myc-Luc or cyclin D1-Luc reporter activity than transfection of either EZH2 or SRC-1 alone in MCF-7 cells under the treatment of estrogen (Fig. 1C), further supporting a connection between EZH2 and estrogen signaling in gene activation.

Since both c-Myc and cyclin D1 are known targets for Wnt pathways (16, 47, 50), we next investigated the effect of EZH2 on the transactivation of c-Myc and cyclin D1 induced by the Wnt pathway. The EZH2 expression vector and a β-catenin expression vector were either transfected alone or in combination to MCF-7 cells, and the luciferase activation driven by the c-Myc or cyclin D1 promoter was assayed. As shown in Fig. 1D, EZH2 and β-catenin appeared to have an additive effect on the activation of the c-Myc and cyclin D1 promoters, suggesting that there might also be a connection between EZH2 activity and the Wnt pathway in gene activation.

Measurement of the transcription of endogenous c-Myc and cyclin D1 by real-time RT-PCR supported the observation described above (Fig. 2A). In addition, the effect of EZH2 on gene transactivation appeared to be EZH2 specific, as its homolog EZH1 did not have such an effect (Fig. 2B), and the effect of EZH2 also appeared to be specific for ER, as EZH2 had little effect on androgen receptor (AR)-regulated gene transcription in the prostate cancer cell line LnCAP (Fig. 2C).

EZH2 transactivated c-Myc and cyclin D1 promoters.

To further support an EZH2 role in the activation of c-Myc and cyclin D1 promoters, we next mapped the cis-elements within the c-Myc and cyclin D1 promoters that are responsible for EZH2 transactivation. The c-Myc promoter and its mutant constructs, a synthetic sequence containing four copies of the TCF-binding site and its mutant (16), and the cyclin D1 promoter and its mutant constructs (50) (Fig. 2A) were transfected into MCF-7 cells with or without coexpression of EZH2. The reporter activity was then measured under these experimental conditions. As shown in Fig. 3A, mutation of TCF-binding sites in either the c-Myc promoter or cyclin D1 promoter abolished EZH2 transactivation activity. In addition, EZH2 also strongly transactivated the reporter gene driven by the synthetic TCF sequence, and mutation of TCF-binding sites abrogated the EZH2 transactivation activity. These experiments clearly demonstrated that the transactivation activity of EZH2 is mediated by the TCF/β-catenin-binding sites in the c-Myc and cyclin D1 promoters, further supporting the observation that EZH2 enhanced β-catenin-regulated transcription of c-Myc and cyclin D1.

Next, we tested the effect of EZH2 on endogenous c-Myc and cyclin D1 protein expression. As shown in Fig. 3B, overexpression of EZH2 in MCF-7 cells resulted in increased c-Myc and cyclin D1 protein expression in the presence but not in the absence of estrogen treatment (Fig. 3B, left panel). In the meanwhile, RNAi was applied to knock down the expression of EZH2 protein, and the effect of the knockdown on the c-Myc and cyclin D1 protein levels was measured by Western blotting. The results indicated that when the expression of EZH2 was silenced, the protein expression of c-Myc and cyclin D1 was significantly decreased, whereas either overexpression or knockdown of EZH2 had limited effects on the expression of other cell cycle-regulated genes, such as cyclin D2 (which is undetectable in MCF-7 cells due to promoter methylation) (9), cyclin A2, and cyclin E1 (Fig. 3B, middle panel).

To further consolidate the connection of EZH2 with the Wnt pathway in transactivation of c-Myc and cyclin D1 expression, we next investigated the effect of β-catenin knockdown by RNAi (Fig. 3B, right panel) on the transactivation of c-Myc and cyclin D1 by EZH2. As stated before, either EZH2 or β-catenin enhanced the promoter activity of c-Myc and cyclin D1, and EZH2 and β-catenin in combination had an additive effect (Fig. 1D). However, in β-catenin-silenced cells, not only was the β-catenin-enhanced activation of the c-Myc and cyclin D1 promoters diminished and the additive effect of EZH2 and β-catenin no longer observed, but also the enhancement effect of EZH2 was severely affected (Fig. 3C), suggesting that EZH2 might be involved in the Wnt pathway.

Molecular mechanism for transactivation activity of EZH2.

We next investigated the molecular mechanism underlying transcription potentiation of c-Myc and cyclin D1 by EZH2 in response to estrogen and Wnt signaling. Estrogen is believed to initiate its signaling pathway mainly through its binding to ERs (31, 42). Liganded ERs then bind to their cognate gene promoters, where coactivator recruitment occurs by means of protein-protein interaction (28, 31). Since ERα is the isoform that mediates the most current known estrogen biological activities, we wanted to test if there is a physical association between ERα and EZH2. For this purpose, GST pull-down experiments with bacterially expressed GST-ERα and in vitro-transcribed/translated EZH2 and reciprocal coimmunoprecipitation (co-IP) were performed. As shown in Fig. 4, GST pull-down experiments revealed a specific interaction between ERα and EZH2 (Fig. 4A, left panel). Reciprocal co-IP experiments also indicated that ERα and EZH2 interact in vivo (Fig. 4B, upper panels). Notably, co-IP experiments indicated that the interaction between ERα and EZH2 was estrogen dependent and ERα specific, as ERβ and AR did not interact with EZH2 in vivo (Fig. 4C, upper panels). In addition, while reciprocal co-IP experiments with antibodies against EZH2 and SRC-1 revealed that EZH2 and SRC-1 were present in the same protein complex (Fig. 4B, middle panels), no EZH2 and SRC-1 interaction was found in GST pull-down experiments (Fig. 4A, left panel), suggesting that there is not a direct physical interaction between EZH2 and SRC-1. On the other hand, EZH2 was found to interact with β-catenin both in vitro (Fig. 4A, left panel) and in vivo (Fig. 4B, bottom panels). These results strongly suggest that β-catenin-EZH2-ERα-SRC-1 was among the components of the transcription complex formed in activation of the c-Myc and cyclin D1 promoters.

In order to further support an in vivo interaction of EZH2 with estrogen-Wnt signaling components, FLAG-tagged EZH2 was expressed in MCF-7 cells. Nuclear extracts were prepared from these cells and were incubated with FLAG antibody-conjugated Sepharaose 4B columns. The elutes were resolved on SDS-PAGE and were immunoblotted with antibodies against ERα, β-catenin, SRC-1, and β-actin. As shown in Fig. 4C (middle left panels), the protein complex that was pulled down with anti-FLAG antibody contained EZH2, ERα, β-catenin, and SRC-1, supporting the argument that these proteins exist in a functional protein complex in vivo. In addition, the formation of this complex was dependent on ERα, as knockdown of the expression of ERα (Fig. 4C, bottom panels) resulted in undetected ERα, β-catenin, and SRC-1 in immunoprecipitates pulled down by anti-FLAG (Fig. 4C, middle right panels).

ERs can bind the genes whose promoters do not contain any estrogen-responsive elements (31). Neither the c-Myc nor cyclin D1 promoter harbors canonical estrogen-responsive elements, but they do contain multiple TCF/β-catenin-binding sites (16, 47, 50). In view of a previous report that ERα coimmunoprecipitated with β-catenin (22), there is a strong possibility that ERα targets c-Myc and cyclin D1 through its interaction with TCF/β-catenin. However, a direct interaction between ERα and β-catenin was not detected by GST pull down in our experiments (Fig. 4A, right panel), and failure to detect a direct ERα-β-catenin interaction was also reported by other groups (57). In light of the observations that EZH2 directly interacts with ERα and β-catenin and EZH2 exerts its transactivation activity via TCF/β-catenin-binding sites (Fig. 3A), these experiments placed EZH2 in the intersection of the estrogen and Wnt pathways, at least in the transactivation of c-Myc and cyclin D1, suggesting EZH2 functions as an integrator of the Wnt pathway and estrogen signaling. This model was supported by our experiments showing that while knockdown of the expression of either EZH2 or ERα decreased the c-Myc and cyclin D1 promoter activity, β-catenin was essential for both estrogen and Wnt signaling in activation of the c-Myc and cyclin D1 promoter (Fig. 4D, left panels).

It is believed that EZH2 exerts its biological activities through formation of PRC protein complexes with other proteins, such as EED and SUZ12 (5). In order to investigate whether the transactivation activity of EZH2 and the association of EZH2 with ERα and β-catenin was a manifestation of EZH2 itself or of a PRC protein complex, we performed reciprocal coimmunoprecipitation with antibodies against EED, SUZ12, ERα, and β-catenin. The results of these experiments indicated that there were no physical associations between ERα and EED/SUZ12 and between β-catenin and EED/SUZ12 (data not shown). In addition, neither overexpression nor knockdown of the expression of EED or SUZ12 affected the transactivation activity of EZH2 (Fig. 4D, right panels). The results of RNAi experiments are shown in Fig. 4E (left panels). Furthermore, it has been reported that overexpression of EZH2 in tissue culture promotes formation of a previously undescribed PRC, PRC4, that contains histone deacetylase SirT1 and isoform 2 of the PRC component Eed (EED2) (24). However, neither EED2 nor SirT1 was detected in coimmunoprecipitation experiments with antibodies against ERα (Fig. 4E, middle panels), whereas SirT1 was detected in coimmunoprecipitations with anti-EED2 (Fig. 4E, right panel). Collectively, these results indicated that the transactivation activity of EZH2 was not from a PRC protein complex.

Recruitment of EZH2 on the promoters of c-Myc and cyclin D1.

In order to determine whether EZH2 is indeed associated with c-Myc and cyclin D1 promoters and to further investigate the association of β-catenin-EZH2-ERα on c-Myc and cyclin D1 promoters in vivo, we next performed ChIP and re-ChIP according to the procedure described previously (44, 60) by quantitative PCR to examine the recruitment pattern of β-catenin, EZH2, and ERα on c-Myc and cyclin D1 promoters. In these experiments, MCF-7 cells were grown in the absence of estrogen for at least 3 days followed by no treatment or treatment with saturating levels of E2 for 45 min. The presence of β-catenin, EZH2, and ERα on c-Myc and cyclin D1 promoters was first determined using ChIP with antibodies against these proteins. Then, both the precipitates and the supernatants were subjected to re-ChIP. As shown in Fig. 5, the presence of all three, β-catenin, EZH2, and ERα, could be detected on the c-Myc promoter under the experimental conditions and was dependent on ERα (Fig. 5A, upper panels). As we reported earlier for p160 proteins (60), this could be explained by one of the following scenarios: each of β-catenin, EZH2, and ERα could be associated with a different promoter in different cells; pairs of three proteins could be associated with a different promoter in different cells; or the three proteins could exist in the same complex. The re-ChIP experiments demonstrated that, in precipitates, the c-Myc promoter that was immunoprecipitated with antibodies against ERα could be reimmunoprecipitated with antibodies against β-catenin and EZH2; likewise, the c-Myc promoter that was immunoprecipitated with antibodies against β-catenin could be reimmunoprecipitated with antibodies against ERα and EZH2; analogously the c-Myc promoter that was immunoprecipitated with antibodies against EZH2 could be reimmunoprecipitated with antibodies against ERα and β-catenin (Fig. 5A, lower three panels). On the other hand, supernatants from ChIP with antibodies against β-catenin, EZH2, or ERα showed no detection of the other two proteins on the c-Myc promoter (Fig. 5A, lower three panels). Similar results were obtained with the cyclin D1 promoter and in T47-D cells, and there was no detectable EED or SUZ12 on c-Myc and cyclin D1 promoters under the experimental conditions (data not shown). The binding of ERα, β-catenin, and EZH2 on the promoter of cyclin D1 was also confirmed by real-time quantitative PCR in which the associations of EZH2 with the promoter of one of its known target genes, myelin transcription factor 1 (MYT1) (19) (positive control), and with β-actin (negative control) were validated (Fig. 5C). These experiments strongly suggest that β-catenin-EZH2-ERα existed in the same protein complex on c-Myc and cyclin D1 promoters in vivo.

It is believed that the normal function of EZH2 in transcription repression is associated with the methylation of histone H3 lysine 27 (H3K27) (4, 25). In order to further support the transactivation activity of EZH2, the methylation status of H3K27 around the c-Myc promoter was examined by ChIP assays. The results indicated that neither overexpression nor knockdown of EZH2 affected the methylation status of H3K27 (Fig. 5D). In contrast, the overexpression of EZH2 was associated with the methylation of H3K4, a well-characterized gene activation mark (30), further supporting EZH2's role in gene activation. The knockdown of protein expression was confirmed by Western blotting (Fig. 5B).

The transcription activation function of EZH2 is separated from its SET domain.

Genetic evolution analysis revealed four conserved domains in human EZH1, human EZH2, mouse EZH1, mouse EZH2, and Drosophila E(Z) (17, 26, 33). The SET domain in the carboxy terminal is the most highly conserved domain, is required for the HMTase activity of several SET-containing proteins, and is believed to mediate the transcription repression activity of EZH2 (5). A cysteine-rich region precedes the SET domain. In the amino-terminal region, EZH2 harbors domain I and domain II with proposed protein-protein interaction functions. In order to further delineate the molecular basis for the EZH2 role in connecting the estrogen and Wnt signaling, we generated EZH2 mutants in which the SET, cysteine-rich region, domain I, or domain II was individually or combinatorially deleted (Fig. 6A). The effects of these mutants on the transactivation of estrogen-induced c-Myc and cyclin D1 promoters were analyzed. As shown in Fig. 6B, while deletion of the SET or the cysteine-rich domain either alone or in combination had minimal effect on the promoter activity of c-Myc and cyclin D1, deletion of either domain I or domain II rendered a diminished effect of EZH2 on c-Myc and cyclin D1 promoter activation, suggesting that both domain I and domain II are essential for the transactivation activity of EZH2.

Because we demonstrated that EZH2 directly interacted with ERα and β-catenin (Fig. 4A and B), we next analyzed the functional domain(s) in EZH2 that may be involved in these interactions by GST pull-down experiments using the above-described EZH2 mutants. As shown in Fig. 6C, while the deletions of the cysteine-rich domain or SET domain still preserved the interaction ability of EZH2 with ERα and β-catenin, deletion of domain I abolished the interaction of EZH2 with both ERα and β-catenin, indicating that both ERα and β-catenin interact directly with EZH2 through domain I of EZH2.

Because domain II of EZH2 was also required for EZH2 transactivation activity (Fig. 6B) and this structure is also proposed for a protein-protein interaction function (17, 26, 33), we next screened for, by GST pull-down assays, a possible transcription cofactor(s) that has been implicated in ER and/or Wnt signaling-mediated transcription and that might directly interact with domain II of EZH2. Since we had already shown that SRC-1 did not interact directly with EZH2 (Fig. 4A), we thus selected histone acetyltransferases CBP, p300, and pCAF, histone methyltransferases CARM1 and PRMT1, human SWI/SNF components Brg1, BAF250, and BAF170, and human Mediator components TRAP220/DRIP205 and TRAP150/DRIP150 to test, individually, whether these transcription regulators could interact with EZH2. Among these proteins, our experiments detected that only TRAP220/DRIP205 directly interacted with EZH2, and we showed that this interaction was dependent on domain II of EZH2 (Fig. 6D, upper panel). In vivo interaction of EZH2 with TRAP220/DRIP205 was also confirmed in MCF-7 cells by coimmunoprecipitation assays (Fig. 6D, lower panel). In addition, we showed that TRAP220/DRIP205 was indeed able to enhance the transactivation activity of EZH2 on the c-Myc promoter in MCF-7 cells (Fig. 6E).

Collectively, these experiments clearly established domain I as the interaction domain for both ERα and β-catenin and suggested that domain II serves as a platform for the Mediator interaction. These data also suggested that the transactivation activity and transrepression activity of EZH2 reside in separated domains and thus provided a mechanism for EZH2's dual function in transcription activation and repression.

Promotion of cell cycle progression by EZH2.

In order to determine whether the integration function of EZH2 for gene activation mediated by the estrogen and Wnt pathways extends to a physiologically relevant response in breast cancer cells, we examined the effect of EZH2 on cell cycle progression. Estrogen is normally required for the G₁/S transition of MCF-7 cells, and estrogen deprivation leads to a significant G₁ arrest (9). We cotransfected estrogen-deprived MCF-7 cells with EZH2 or an EZH2 siRNA together with a GFP construct. The cell cycle profile of the GFP-expressing population was then analyzed by flow cytometry after estrogen stimulation. As shown in Fig. 7A, overexpression of EZH2 led to a significant increase of cells in the S phase and G₂/M phase, whereas knockdown of the expression of EZH2 with siRNA resulted in accumulation of cells in the G₀/G₁ phases. Promotion of cell cycle progression was also observed in cells transfected with the SET domain-deleted EZH2. Moreover, the inhibitory effect of EZH2 knockdown on the G₁/S transition of the cell cycle could be partially rescued by overexpression of c-Myc or cyclin D1 but not cyclin D2.

To further support the role of EZH2 in promoting cell cycle progression, MCF-7 cells were transfected with an EZH2 expression construct or an EZH2 siRNA construct. Twenty-four hours after transfection, cells were switched to normal medium or treated with 1 mM of ICI 182 780 for 24 h before addition of E2 for different times. The cells were then collected for cell cycle profile analysis by cell flow cytometry. The results indicated that EZH2 was able to facilitate the E2-stimulated G₁/S transition of MCF-7 cells (Fig. 7B). The expression of EZH2, c-Myc, cyclin D1, and other cell cycle-related genes is shown in Fig. 7C. These experiments indicated that EZH2 promotes the G₁/S transition of MCF-7 cells through its transactivation of c-Myc and cyclin D1 in these cells, and the effect of EZH2 on cell cycle progression is independent of its SET domain.