PCR Primers.

PCR primer pairs, including their specificity, identification tag, orientation (forward, F; reverse, R), sequence, and product length were as follows: screening of P1 library for ELC-atg (SL06 F exon 1 gcctcagattatctgccat, SL07 R exon 2 atcattagcaccccccagag, 1090 bp); Southern probe (SL06 F, SL19 R intron 1 atggagcccacagctataag, 303 bp); semiquantitative PCR: ELC-atg (SL06 F, 3′ELC R agacacagggctccttctggt, 350 bp); ELC-acg (SL21 F gcctcagatcgtctgccac, 3′ELC R, 350bp); SLC (HLT77 F exon 1/2 ccctggacccaaggcagt, SL30 R exon 3/4 agttctcttgcagcccttgg, 320 bp); SLC-ser (SL42 F exon 2/3 atcccggcaatcctgttctc, SL30 R, 200 bp); SLC-leu (SL43 F exon 2/3 atcccggcaatcctgttctt, SL30 R, 200 bp); Dec205 (HLT28 F gttgcacctgtgattggtgg, HLT29 R gggagtcttgttgaagggaac, 450 bp); CD11c (HLT86 F cctggatagcctttcttctg, HLT87 R tgcacagtaggaccacaagc, 320 bp); gp38 (HLT84 F ctctggtaccaacgcagaga, HLT67 R ttagggcgagaaccttcca, 320 bp); HPRT (F gttggatacaggccagactttgttg, R gagggtaggctggcctatggct 350 bp); quantitative PCR: ELC-atg (HLT72 F ctgcctcagattatctgccat, HLT73 R tcattagcaccccccagagt, probe, tggaccttcccagccccaactctg); ELC-acg (SL21 F, HLT73 R, probe as for ELC-atg); SLC (HLT77 F ccctggacccaaggcagt, HLT75 R aggcttagagtgcttccggg, probe, tcccatcccggcaatcctgttctc); HPRT (HLT78 F aggttgcaagcttgctggt, HLT79 R tgaagtactcattatagtcaagggca, probe, tgttggatacaggccagactttgttggat). Analytical PCR conditions were as follows: 94°C for 5 min; 30 cycles of 60°C for 45 s, 72°C for 1 min, 94°C for 45 s; and 72°C for 10 min. Quantitative RT-PCR was performed on an ABI 770 sequence detection instrument (TaqMan) using TaqMan PCR core reagent kit (Perkin–Elmer) following the manufacturer's instructions. Expression was quantified using HPRT as a reference.

ELC-Expressed Sequence Tag (EST) and Genomic Analysis.

All ELC EST sequences were obtained from GenBank using EST AA444730 (15) as template and the BLAST program for homology searches and multiple sequence alignments. During reanalysis of this EST, we discovered three sequence errors in the reported (15) 3′-untranslated region (669G, 692T, and 707T should be 669A, 692A, and 707C). Of six further ESTs identified, one (AA245687) corresponded to the previously described cDNA, and five (AI172790, AA265632, AA168274, AA839365, and AA537424) had ACG in place of the ATG start codon plus 4–10 additional nucleotide changes. P1 clones P1–38, -39, -40, and -41 were isolated from the Incyte Pharmaceuticals (Palo Alto, CA) mouse 129/sv P1 library by screening with primers specific for SLC and were kindly provided by M. Gunn (Duke University, Durham, NC). The same library was screened for ELC-atg genes by PCR using primers SL06 and SL07 and led to isolation of P1–364. The ELC gene from P1–364 was subcloned into pBluescript (Stratagene) and sequenced.

Western Blot Analysis.

A pool of LNs and spleen was homogenized in ice-cold lysis buffer (120 mM NaCl/50 mM Tris, pH 8.0/1 mM EDTA/6 mM EGTA/1% Nonidet P-40) containing protease inhibitors (1 mM PMSF/1 mM benzamidine/5 μg/ml Leupeptin/5 μg/ml apoprotin). Sepharose CL-4B preabsorbed lysates were incubated with heparin-Sepharose (Amersham Pharmacia); after rotating for 1 h at 4°C, the Sepharose was washed three times and boiled in reducing sample buffer. Western blotting was with goat anti-mouse ELC or SLC (R & D Systems) followed by anti-goat horseradish peroxidase (Jackson ImmunoResearch), and development was with ECL Plus (Amersham Pharmacia). Specificity was controlled by showing lack of reactivity of the ELC- and SLC-specific antibodies with SLC and ELC protein, respectively.

Cell Purification.

The spleen samples and DCs used for ELC expression analysis were prepared as described (14). For sorting, DCs were metrizamide enriched from ≈50 collagenase type IV (Worthington) treated C57BL/6 spleens (14), stained with CD11c-FITC, CD3-PE (PharMingen), B220-PE, and CD8α-TC (Caltag, South San Francisco, CA), and CD8α⁺ or CD8α⁻ CD11c⁺B220⁻CD3⁻ cells were purified to >97% using a FACsStar plus (Becton Dickinson). B cells were identified with anti-B220 and sorted to 99% purity. Total RNA was extracted using Trizol (GIBCO/BRL), and about 1 μg was reverse transcribed for 1 h at 42°C using Advantage RT-for-PCR kit (CLONTECH).

Immunohistochemistry.

Seven to eight-micrometer frozen sections were acetone fixed for 10 min and air dried. For double staining, anti-SLC antibody (R & D Systems) was applied first, followed by biotinylated donkey anti-goat IgG (The Jackson Laboratory) and alkaline phosphatase-coupled streptavidin-ABC (Vector Laboratories), and then developed with Fast Blue (Sigma)/Naphthol AS-MX. Sections were blocked with RPMI 1640 supplemented with 1 μg/ml dBiotin (Sigma) and 5% goat serum. After washing, sections were stained with hamster anti-mouse gp38 (12), mouse anti-I-A^p (PharMingen), or sheep anti-IgD (The Binding Site, San Diego, CA) followed by horseradish peroxidase-coupled anti-hamster IgG (Jackson ImmunoResearch), streptavidin (Amersham Pharmacia), or anti-sheep IgG (Southern Biotechnology Associates). The peroxidase reaction was developed with diaminobenzidine (Sigma)/H₂O₂. In control experiments, preabsorption of the anti-SLC antibody with SLC was found to block staining.

plt/plt Mice Lack the ELC-atg Gene and ELC Protein.

Our finding of multiple transcribed ELC genes, together with the knowledge that the ELC and SLC genes are closely linked (11), prompted us to consider whether the reduced amount of ELC mRNA in plt/plt mice (3) was caused by deletion of one or more of the ELC genes. Strikingly, Southern blot analysis of NcoI-digested plt/plt genomic DNA showed that the 2.8-kb band characteristic for the ELC-atg gene was absent (Fig. ​(Fig.11C). No evidence for another band besides the 5-kb band was obtained in plt/plt mice, whereas both the 2.8- and 5-kb bands could be detected in BALB/c controls (Fig. ​(Fig.11C). By Western blot, ELC was undetectable in extracts from plt/plt spleen and LNs, whereas it could be detected in extracts from wild-type spleen and LNs, even after 50-fold dilution (Fig. ​(Fig.11D). Therefore, although there are some reports of low-level translation from ACG codons (16), our findings indicate that there is no detectable translation from the ELC-acg gene(s) in plt/plt mice. These animals are therefore null for ELC. Analysis of the lymphoid extracts for SLC established, as expected from the previous mRNA analysis (3), that little of this protein could be detected in plt/plt lymphoid tissue (Fig. ​(Fig.11D). In summary, plt/plt mice lack the ELC-atg and SLC-ser genes and, as a result, are double-deficient for ELC and SLC protein in lymphoid tissues.

ELC and SLC Expression by Radiation-Resistant Cells.

To characterize the cell types producing ELC and SLC, we asked whether it was possible to restore expression of these chemokines in secondary lymphoid organs of plt/plt mice by bone marrow transfer. Bone marrow chimeras were generated by transferring Ly9.1⁻ wild-type bone marrow into lethally irradiated Ly9.1⁺ plt/plt recipients (wt→plt/plt). Analysis of Ly9.1 expression on B220⁺ cells and CD11c⁺ cells established that recipient B cells and DCs had been efficiently replaced by donor-derived cells (Fig. ​(Fig.22A). The number of DCs in spleens of plt/plt mice was in the normal range, as previously reported (3), and this was also the case in the wt→plt/plt chimeras. We also found that these animals had a wild-type ratio of CD8⁺ to CD8⁻ DCs (Fig. ​(Fig.22A). RT-PCR analysis of RNA from lymphoid organs of the wt→plt/plt chimeric mice established that a small amount of ELC-atg mRNA was restored (Fig. ​(Fig.22B). In contrast, there was no restoration of SLC-ser mRNA expression (Fig. ​(Fig.22B). Surprisingly, some low level expression of SLC-leu was found in lymphoid tissues (Fig. ​(Fig.22B), which has not been detected previously by Northern blot analysis (3, 10). As expected from the genetic studies (Fig. ​(Fig.11C), ELC-acg pseudogene transcripts were readily detected in plt/plt mice and were not noticeably altered by bone marrow replacement (Fig. ​(Fig.22B). Quantitative PCR analysis showed that the reconstituted ELC-atg expression in chimeric spleen was between 0.1 and 1% of that in wild-type spleen (Fig. ​(Fig.22C), whereas there was no restoration of SLC expression (Fig. ​(Fig.22C).

Open in a separate window

Figure 2

Partial restoration of ELC but not SLC mRNA expression in spleen of plt/plt mice that have been reconstituted with wild-type bone marrow. (A) Flow cytometric analysis of splenocytes from Ly9.1⁺ plt/plt mice, Ly9.1⁻ B10D2 wild-type mice (wt), or irradiated plt/plt mice that had been reconstituted with wild-type bone marrow (wt →plt/plt). Left histograms show Ly9.1 on B cells (B220⁺), and central histograms show Ly9.1 on DCs (CD11c⁺B220⁻CD3⁻). Right histograms display the proportions of CD11c⁺ cells that express CD8α. Numbers indicate the percentage of cells in the gated population. The data are representative of at least four mice of each type. (B) RT-PCR analysis of ELC and SLC mRNA expression in spleen of wild-type (wt), plt/plt, and bone marrow chimeric mice. Total spleen RNA from the indicated mice was analyzed by RT-PCR with primers specific for ELC-atg, ELC-acg, SLC-ser, SLC-leu, and HPRT. (C) Real-time quantitative RT-PCR analysis of ELC-atg and total SLC expression in samples of the same type as in B. Each dot represents an individual mouse, and bars represent the mean.

One possible explanation for the low reconstitution of ELC-atg in wt→plt/plt chimeric mice was that the lack of endogenous SLC and ELC in the recipient limited the ability of appropriate hematopoietic cells (such as DCs) to be recruited to the spleen, causing an underestimate of the normal hematopoietic contribution to chemokine expression. The efficient reconstitution of the plt/plt spleen by donor lymphocytes and CD11c⁺ cells (Fig. ​(Fig.22A) argued against this possibility. As a further approach to test hematopoietic contribution to chemokine expression, reciprocal chimeras were made, where plt/plt bone marrow was used to reconstitute irradiated wild-type recipients (plt/plt→wt). Despite flow cytometric confirmation that the majority of lymphocytes and DCs in the reconstituted animals were derived from the plt/plt donor (not shown), semiquantitative and quantitative PCR analysis demonstrated little or no reduction in ELC-atg and SLC expression (plt/plt→wt; Fig. ​Fig.22 B and C). These findings are in agreement with the results in the wt→plt/plt chimeras that 0.1–1% of the functional ELC transcripts in spleen are made by bone marrow-derived cells and that the bulk of ELC, and possibly all of the SLC-ser, is made by radiation-resistant cells that most likely are not bone marrow derived.

Coexpression of ELC and SLC by T Zone Cells.

Previous in situ hybridization studies have shown extensive expression of ELC and SLC throughout the T zone of secondary lymphoid organs. To determine whether ELC and SLC are produced by exclusive or overlapping subsets of cells, we performed double in situ hybridization analysis (Fig. ​(Fig.3).3). Although the ELC probe is unable to distinguish the functional and nonfunctional ELC transcripts, semiquantitative RT-PCR analysis with gene-specific primers indicated that more than half of the total ELC signal in C57BL/6 spleen was from the ELC-atg gene (data not shown). Strikingly, the double in situ hybridization analysis revealed a large fraction of cells staining with both in situ probes, establishing that many cells coexpress SLC and ELC (Fig. ​(Fig.33A). HEVs were positive for SLC but not ELC (Fig. ​(Fig.3 3 A and B), as expected (15, 17). In addition, SLC single-positive cells were sometimes present at the border between T zone and follicles and in interfollicular regions (Fig.​(Fig.33B). A small number of ELC single-positive cells were also identified (Fig.​(Fig.33C), perhaps corresponding to the ELC-producing cells shown in the bone marrow chimera studies (Fig. ​(Fig.2)2) to be of hematopoietic origin.

Open in a separate window

Figure 3

Coexpression of ELC and SLC in LN T zone. (A–C) Bright-field micrographs showing hybridization of mouse LN with the following antisense probes: (A and C) DIG-labeled SLC probe (blue) and FITC-labeled ELC probe (red); (B) DIG-labeled ELC probe (blue) and FITC-labeled SLC probe (red). Inset in A shows examples of ELC/SLC double-positive cells. In B and C, the blue reaction product is overdeveloped so that double-positive cells are not visible, but red single-positive cells are apparent. f, follicle; t, T zone. Arrowheads show examples of single-positive cells. (Magnification: A and B, ×20; C, ×40.)

Chemokine Expression in Stromal Cells and DCs.

As the above studies indicated that ELC and SLC were made predominantly by radiation-resistant cells, we tested whether chemokine transcripts were present in spleen preparations enriched for stromal cells (Fig. ​(Fig.44A). When cells are teased from spleen tissue by mechanical mashing, it is thought that most of the hematopoietic cells are released into suspension, whereas collagen fiber-associated stromal cells and other tightly adherent cells remain as a clump of nonsuspendable material. To determine the extent of stromal cell depletion or enrichment in suspendable and nonsuspendable spleen fractions, we measured levels of the stromal cell marker, gp38 (12). Compared with RNA prepared from total spleen, gp38 was depleted in the cell suspension and enriched in the spleen stroma preparation (Fig. ​(Fig.44A). Analysis of ELC-atg and SLC transcript levels showed a very similar trend, with strong enrichment in the spleen stroma preparation (Fig. ​(Fig.44A). To measure ELC expression in DCs, splenic CD8⁺ and CD8⁻ DCs were FACS sorted from collagenase-digested spleen tissue. B and T lymphocytes have previously been shown to lack expression of ELC (15), and FACS-sorted B cells were used as a negative control. RT-PCR analysis for CD11c and DEC205 showed the expected enrichment for these markers in the DC populations, with CD8⁺ DCs expressing greater amounts of DEC205 than CD8⁻ DCs (Fig. ​(Fig.44B). DEC205 transcripts were also detected in B cells (Fig. ​(Fig.44B), consistent with a previous report that B cells express DEC205 protein (19). ELC-atg was detectable in both DC populations, but not in B cells (Fig. ​(Fig.44B), and quantitative analysis indicated CD8⁺ DCs express ≈5-fold greater amounts than CD8⁻ DCs (Fig. ​(Fig.44C). In agreement with the bone marrow chimera studies (Fig. ​(Fig.2),2), quantitative RT-PCR indicated that DCs account for only a small fraction of the ELC-atg signal present in total spleen (Fig. ​(Fig.44C). It should be noted that although the DC preparations were greater than 97% CD11c⁺, the presence of a positive PCR reaction product for gp38 suggests that some contaminating stromal cells may be present (Fig. ​(Fig.44B). However, the gp38 signal is similar in the CD8⁻ and CD8⁺ preparations, and it is therefore most likely that the greater ELC-atg expression in the CD8⁺ fraction is a result of expression by CD8⁺ DCs. Analysis of SLC indicated little or no expression in DCs (Fig. ​(Fig.44 B and C).

Open in a separate window

Figure 4

ELC and SLC mRNA expression in spleen stromal cells and DCs. (A and B) Semiquantitative RT-PCR for the indicated transcripts using RNA extracted from the following: (A) total spleen tissue, a suspension of spleen cells obtained after mechanical mashing of spleen through a cell strainer and the remaining nonsuspendable fraction (spleen stroma); (B) sorted CD8α⁻ and CD8α⁺ DCs (CD11c⁺B220⁻CD3⁻) and sorted B cells (B220⁺). In A and B, serial 1:5 dilutions of each cDNA sample were used as template in PCR. (C) Quantitative RT-PCR analysis of ELC-atg and SLC expression in samples prepared as in A and B. Expression is plotted as % of corresponding mRNA in the total spleen.

Distribution of SLC Protein in Lymphoid Tissues.

To further characterize the relationship between stromal cells and chemokine-expressing cells, we stained sections for gp38 and SLC protein (Fig. ​(Fig.55 A–C). Staining for ELC so far has not been successful (not shown). As previously reported (12), anti-gp38 stains the extensive network of collagen fiber-associated stromal cells distributed throughout the lymphoid T zone (Fig. ​(Fig.55A). Immunohistochemical analysis of SLC showed strong staining on HEVs (not shown and Fig. ​Fig.55D) and reticular networks in the T zone (Fig. ​(Fig.55B). The strong SLC protein staining was comparable to the SLC RNA expression pattern (17), whereas a weaker level of protein staining was detectable throughout the T zone. When the gp38 and SLC stains were combined, the most intense SLC staining was found associated with gp38⁺ cells (Fig. ​(Fig.55C), and the morphology of these cells was often similar to the SLC/ELC double-positive cells identified by in situ hybridization (Fig. ​(Fig.33A). A similar pattern of gp38 and SLC costaining was found in the T zone of spleen (data not shown). Interestingly, the central arteriole in the spleen was positive for SLC protein (data not shown). All of the SLC staining was specific, as it was not found in tissues from plt/plt mice (Fig. ​(Fig.55C, Inset at bottom, right). In contrast to the overlap between SLC and gp38 staining, I-A and SLC costaining showed there was little overlap (Fig. ​(Fig.55D), supporting the notion that gp38⁺ stromal cells express SLC, whereas MHC class II⁺ DCs do not.

Open in a separate window

Figure 5

Distribution of SLC protein with respect to stromal cells and DCs. Immunohistochemistry on serial C57BL/6 LN sections for the stromal cell marker gp38 (A and C, in brown), for SLC (B, C, and D, in blue), or for I-A (D, in brown). Insets in lower left of each image show enlarged views of cells from the same tissue section. Inset in lower right of C shows a region of plt/plt LN stained identically to the wild-type tissue section shown in this panel. (Magnification: ×20.)

We thank M. Gunn and H. Nakano for providing the plt/plt mice, M. Gunn for P1 clones, and Mark Ansel, Karin Reif, and Steve Rosen for critical reading of the manuscript. This work was supported in part by National Institutes of Health Grant AI45073. S.A.L. was supported by the Swiss National Science Foundation and is presently supported by the Human Frontier Science Program; H.L.T. was supported by the American Lung Association; J.G.C. is a Packard Fellow and an investigator of the Howard Hughes Medical Institute.