Plasmid Construction and Transformation in Trypanosomes

For generation of cell lines expressing double-stranded RNA (dsRNA) for RNAi knockdown, sequences were selected according to their lack of significant identity with other genes to avoid cross-RNAi (Durand-Dubief et al., 2003) by using the RNAit algorithm (Redmond et al., 2003). Primers are available on request from the authors. Gene fragments were amplified by polymerase chain reaction (PCR) on T. brucei genomic DNA, purified on QIAquik columns (QIAGEN, Hilden, Germany), digested with HindIII and XhoI, and ligated in the corresponding sites of the pZJM vector.

For expression of IFT20 fused to a tap-tag, the whole IFT20 sequence was amplified by PCR with the proof-reading enzyme PfuI by using GCGTGCCAAGCTTATGGATGATGATAAACTTGTG as forward primer (HindIII site underlined) and GCATGATATCCTCACGCGAGGCGTGACTCAG (HpaI site underlined) as reverse primer. The amplified product contains the complete coding sequence of IFT20 but the stop codon was not included. It was ligated in the HindIII and EcoRV sites of the pHD918 (Estevez et al., 2001) vector in such a way that the insertion of the IFT20 coding sequence was in-frame with that coding for protein A, generating plasmid pIFT20TAPTAG918. For inducible expression of GFP::IFT52, the full coding sequence of IFT52 was amplified by PCR by using Phusion (Finnzyme, Espoo, Finland), with GCATCATCTAGAATGACGGATGCCCCAAGG (XbaI site underlined) as forward primer and GCATCGGGATCCTCAAAGCTCCTCAATTTC as reverse primer (BamHI site underlined), cloned in the pPCEGFPN2PFR vector (Absalon, Buisson, and Bastin, unpublished data), and the fusion gene encoding GFP::IFT52 was transferred to the pHD430 inducible expression vector (Wirtz and Clayton, 1995). All inserted sequences and flanking regions were sequenced to confirm correct integration and fusion (Genome Express, Meylan, France).

For transfection, pZJM plasmids were linearized with NotI and individually transformed in 29-13 cells. pIFT20TAPTAG918 and pGFPIFT52430 were transformed in the rDNA locus of the PTP or PTH cell lines that express the tet-repressor from the pHD449 or the pHD360 vectors, respectively (Wirtz and Clayton, 1995; Bastin et al., 1999a). In all cases, transfected cells were immediately cloned, and all antibiotic-resistant cell lines were characterized by immunofluorescence with the anti-PFR2 antibody L8C4 or with the anti-protein A antibody (Sigma, St. Louis, MO) or by direct fluorescence observation (GFP). Clones with the clearest distinction between noninduced and induced samples were selected for subcloning by limiting dilution. RNAi was induced by addition of 1 μg of tetracycline per ml of medium, and fresh tetracycline was added at each cell dilution.

Protein Expression and Antibody Production

Given the large size of IFT172, only a fragment was cloned and expressed in Escherichia coli. The forward primer GATGAACGGATCCGCTATTCAAGCATACAAAAAGG was used (BamHI site underlined) and CCGTGCGAATTCGCTACACGAACAGCATCCTCC served as reverse primer (EcoRI site underlined), representing nucleotides 2500–3270 of the IFT172 coding sequence. The PCR product was amplified using a proof-reading enzyme, digested with BamHI and EcoRI, and ligated in compatible sites of the pGEXB vector for protein expression. The plasmids were sequenced to confirm identity and correct fusion with GST. Plasmids were transformed in the competent BL21 strain of E. coli, and protein expression was analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) followed by Coomassie staining. Glutathione transferase (GST)-coupled proteins were purified as described previously (Smith and Johnson, 1988), and 20 μg was injected to BALB/C mice for immunization. After bleeding, sera were absorbed against GST. Sera from mice immunized with GST alone were used as negative controls.

Immunofluorescence and Light Microscopy Analysis

For immunofluorescence with the anti-IFT172 antiserum, intact cells or detergent-extracted cytoskeletons (see below) were washed, settled on poly-l-lysine–coated slides, and fixed either in 4% paraformaldehyde (PFA) for 10 min or in methanol for a maximum of 5 min at −20°C. For PFA fixation, cells were permeabilized with 0.1% Nonidet P-40 for 10 min, and samples were rinsed to remove the excess of detergent. Blocking was performed by an incubation of 45–60 min in phosphate-buffered saline (PBS) containing 0.1% bovine serum albumin, and washed slides were incubated with 1:200 dilution of antiserum for 45–60 min. Slides were washed and incubated with anti-mouse secondary antibodies coupled to Alexa 488 (Invitrogen, Paisley, United Kingdom). For detergent treatment, cells were settled on poly-l-lysine–coated slides and exposed to 1% Nonidet P-40 in PEM buffer (100 mM 1,4-piperazinediethanesulfonic acid [PIPES], pH 6.9, 1 mM MgCl₂, and 1 mM EGTA). For cells expressing the IFT20::TAP tag, both PFA and methanol fixations were used, with a dilution of 1:10,000 of the anti-protein A antibody (Sigma). For cytoskeletons of GFP::IFT52-expressing cells, samples were settled on slides and briefly exposed to 1% Nonidet P-40 in 4 M glycerol, 10 mM PIPES, pH 6.5, 10 mM MgCl₂, and 5 mM EGTA, and then they were washed and processed as described above. The monoclonal antibody (mAb) L8C4 (IgG1) that specifically recognizes PFR2 was used as marker of flagellum assembly (Kohl et al., 1999). The MAb22 is an IgM that detects an as yet unidentified antigen found at the proximal zone of both the mature and the probasal body (Bonhivers and Robinson, unpublished data; Pradel et al., 2006). MAb25 is an IgG2a that recognizes a protein found all along the axoneme (M. Bonhivers and D. Robinson, unpublished data)(Pradel et al., 2006). The MAb 20H5 recognizes centrins and was used at a 1:400 dilution (Sanders and Salisbury, 1994). A rabbit antiserum raised against the Leishmania donovani centrin 1 was used at a 1:1000 dilution (Selvapandiyan et al., 2007). GFP was observed directly or upon immunofluorescence using an anti-GFP antibody (Invitrogen). Subclass-specific secondary antibodies coupled to fluorescein isothiocyanate (Sigma), Alexa 488 or Alexa 594 (Invitrogen), and cyanine (Cy) 3 or Cy5 (Jackson ImmunoResearch Laboratories, West Grove, PA) were used for double labeling. Slides were stained with 4,6-diamidino-2-phenylindole (DAPI) for visualization of kinetoplast and nuclear DNA content. For visualization of GFP on live cells, trypanosomes cultures were mixed with a solution of 3% low melting point agarose (Bio-Rad, Hercules, CA) to reduce cell movement. Samples were observed with a DMR Leica microscope, and images were captured with a CoolSNAP HQ camera (Roper Scientific, Trenton, NJ). Alternatively, slides were also viewed on a DMI4000 microscope (Leica, Wetzlar, Germany), and images were acquired with a Retiga-SRV camera (QImaging, Surrey, BC, Canada). Images were analyzed and cell parameters were measured using the IPLab Spectrum 3.9 software (Scanalytics, Fairfax, VA and BD Biosciences, San Jose, CA) or ImageJ (http://rsb.info.nih.gov/ij/). For movies, cells were filmed using a Cohu camera 460LI, and images were recorded using a DVD recorder.

Electron Microscopy

Cell fixation, embedding, and sectioning for transmission electron microscopy of whole cells or of detergent-treated samples was carried out as described previously (Branche et al., 2006). For scanning electron microscopy, cells were washed in PBS, fixed with 2.5% glutaraldehyde, and treated as reported previously (Absalon et al., 2007).

Reverse Transcription (RT)-PCR

Total RNA was extracted from cells grown with or without tetracycline for the indicated periods of time and purified using TRIzol Reagent (Invitrogen). DNA was eliminated by DNase treatment, and RNA purity was confirmed by conventional PCR. After primer calibration and determination of optimal conditions, semiquantitative RT-PCR was performed as described previously (Durand-Dubief et al., 2003). At least one primer was selected to be outside the region selected for dsRNA expression to avoid amplification of RNA deriving from the dsRNA trigger.

Localization of Endogenous and Tagged IFT Proteins in Mature and Elongating Flagella

To determine the location of IFT proteins in trypanosomes, mouse polyclonal antibodies were raised against a classic IFT marker, the IFT172 protein. It has been localized to the flagellum matrix and to the basal bodies of Chlamydomonas where it is required for flagellum assembly (Pedersen et al., 2005) and in C. elegans (Bell et al., 2006). It is also involved in hedgehog signaling in mouse (Huangfu et al., 2003). A fragment of the trypanosome IFT172 gene was expressed in E. coli to produce a fusion protein with GST for injection in mice. In a second approach, the genes encoding IFT20 or IFT52 were selected for fusion to a protein A tag (Estevez et al., 2001) or to GFP, respectively. IFT20 and IFT52 are proteins belonging to the B complex that have been well characterized in Chlamydomonas (Deane et al., 2001), C. elegans (Collet et al., 1998), or in mammalian cells (Follit et al., 2006). The expression of the fusion proteins is controlled by a tetracycline-inducible promoter, and it is activated by addition of tetracycline to the culture medium. Western blot analysis with an anti-protein A antibody or with an anti-GFP antibody confirmed that the IFT20-tagged protein and the GFP::IFT52 protein are expressed upon addition of tetracycline and that they show an electrophoretic motility corresponding to the expected size of the fusion protein (Supplemental Figure S1, A and B).

Indirect immunofluorescence assay (IFA) with anti-IFT172 antibodies produced a defined pattern on trypanosomes fixed in methanol: a strong signal is observed at the basal body region, and a succession of closely spaced spots is found all along the length of the flagellum until its distal tip (Figure 2A). The same pattern was observed in cells possessing two flagella, and no visible difference in signal could be detected between the new (no matter its length) and the old flagellum (see, for example, the cell at the bottom left of Figure 2A). The same antiserum used on PFA-fixed trypanosomes stained the flagellar compartment but not the basal body (data not shown), possibly due to a more difficult access as noted previously for IFT20 in mammalian cells (Follit et al., 2006). IFT20 fused to a protein A tag also localized to the flagellum and to the basal body, with a weak signal on the cell body (Figure 2B). Double staining with markers of various organelles (endoplasmic reticulum, lysosomes, mitochondria) failed to reveal a specific association, indicating that the protein is present in the cytosol, possibly as a consequence of overexpression (Supplemental Figure S1, C and D; data not shown). Finally, observation of live cells expressing GFP::IFT52 also demonstrated localization to the basal body and the probasal body and to the flagellar compartment of both old and new flagellum, with a more pronounced localization at the proximal part of the flagellum (data not shown). This pattern was preserved after methanol fixation, although it became less intense (Figure 2C). Staining with an anti-GFP antibody confirmed this localization (Supplemental Figure S1, F and G).

Open in a separate window

Figure 2.

Localization of IFT proteins in trypanosome flagella. (A) Wild-type cells have been fixed in methanol for 5 min and stained with a 1:200 dilution of the anti-IFT172 antiserum (green). (B) Cells expressing IFT20 fused to a protein A tag stained with the anti-protein A antibody (green) after methanol fixation. (C) Direct observation of GFP (green) after methanol fixation of GFP::IFT52- expressing cells. (D–F) Cells from the same populations as shown in A–C but that were detergent-extracted to remove the membrane before PFA (D and E) or methanol (F) fixation. Only the basal body signal and sometimes the proximal part of the flagellum remain positive. All samples were counterstained with DAPI (blue) to visualize nuclear and kinetoplast DNA. Bar, 5 μm.

To further investigate IFT proteins, trypanosomes were treated with 0.1% Nonidet-P40 before fixation. Detergent addition removes the cell body and flagellum membranes but the subpellicular corset of microtubules, the axoneme, the PFR and the basal body complex remain intact (Sherwin and Gull, 1989). Detergent treatment abolishes most of the flagellum staining for IFT172, tagged IFT20, and GFP::IFT52, but a clear signal remains present at the basal body region in both methanol- and PFA-fixed cells (Figure 2, D and F). This indicates that a pool of IFT172 with possibly different biochemical characteristics is present around the basal bodies, as recently suggested for Bardet–Biedl syndrome (BBS) proteins (Nachury et al., 2007).

To further define the positioning of IFT proteins, GFP::IFT52-expressing cells were stained with several markers of the basal body (Figure 3, A–D). Double labeling with MAb22, a mAb marker of the proximal region of both mature and probasal bodies (Pradel et al., 2006; Absalon et al., 2007), showed that GFP::IFT52 was found in a more apical position (Figure 3A), a feature that was reproduced for tagged IFT20 (Supplemental Figure S1E). The antibody against trypanosome basal body component (TBBC) (Dilbeck et al., 1999), a protein found exclusively on the mature basal body that hence produces a single spot in IFA (Absalon and Bastin, unpublished data) showed that GFP::IFT52 was present in an even more apical position (Figure 3B). Costaining was also performed with two antibodies against centrins that localize to mature and probasal bodies, and to a “bilobed” structure found close to the Golgi apparatus (He et al., 2005; Selvapandiyan et al., 2007). The mAb 20H5 recognizes numerous centrin proteins from different organisms, and in detergent-extracted trypanosomes it was found to light up the flagellum, the mature and the probasal body, and a structure close to the flagellar pocket and the Golgi apparatus (Figure 3C). A similar pattern was obtained with the antiserum raised against centrin 1 from the related organism Leishmania donovani, except that the flagellum and basal body signals were weaker (Figure 3D). In both cases, GFP::IFT52 was found to merge with the centrin signal at the mature basal body. The relative position of IFT proteins themselves was investigated upon staining of GFP::IFT52-expressing cells with the anti-IFT172 antiserum, revealing a close but separate location for the two proteins. GFP::IFT52 was found to be in a more apical location compared with IFT172 (Supplemental Figure S2). Double staining of tagged IFT20-expressing cells with the anti-protein A antibody and the anti-IFT172 antiserum showed that these two proteins colocalized at the basal body region (Supplemental Figure S2).

Open in a separate window

Figure 3.

GFP::IFT52 is found at the flagellum and the basal body and displays IFT in old and new flagella. (A–D) GFP::IFT52-expressing cells were fixed in methanol and stained with different antibody markers of the basal body: MAb22 (A), anti-TBBC (B), 20H5 (anti-centrins, C), and an antibody raised against the L. donovani centrin 1 (D). Direct GFP fluorescence is shown in green, the other antibodies are shown in red and DAPI in blue. Insets show 2.5-fold magnification of the indicated basal body regions. (E) Still images of Supplemental Video S1. The first panel shows a phase contrast image of the cell and the others show a succession of fluorescent images with the elapsed time indicated in seconds. The arrow points at a moving IFT particle. Bar, 5 μm.

In conclusion, three different IFT proteins are present along the length of the axoneme where they are sensitive to detergent, and at the mature basal body and frequently at the probasal body where they are resistant to detergent. Importantly, they localize to both old and new flagella, indicating that IFT could operate in mature and elongating flagella.

Movement of GFP::IFT52 Protein in Trypanosome Flagella

Presence of various IFT proteins in both old and new flagella does not necessarily prove that these proteins are trafficking in this compartment. We therefore examined the behavior of the GFP::IFT52 fusion protein in live trypanosomes. Agarose was added to the medium to restrict cell movement, and direct GFP fluorescent signals were monitored by videomicroscopy. This showed unambiguous movement of fluorescent particles in flagella, providing the first actual evidence for intraflagellar transport in trypanosomes (Supplemental Videos 1 and 2; still images of Movie 1 are presented at Figure 3E). Intraflagellar movement was detected in both old and new flagella, but it was more difficult to quantify on the new flagellum because this flagellum is regularly found on top of the cell body, which tends to obliterate the fluorescent signal. IFT was best visualized on the distal end of the mature flagellum (Supplemental Movies S1 and S2), but it was also detected in the new flagellum when it lied on the side of the cell (Supplemental Movie S1). Anterograde events were more frequent and easier to observe (Supplemental Movies S1 and S2), but a few retrograde events could also be detected (Supplemental Movie S2). Rate of anterograde IFT was measured at ~3 μm/s. Retrograde transport was faster, but it could not be estimated accurately due to its low frequency and to the weak GFP signal. These data demonstrate that IFT is indeed active in trypanosomes and operates in both mature and assembling flagella.

IFT-like Particles in the Trypanosome Flagellum

In Chlamydomonas, IFT particles can be recognized on flagellum sections as electron-dense granules found between the membrane and the axoneme (Kozminski et al., 1993). Occasional viewing of such particles has been previously reported in T. brucei, but detailed analysis is lacking (Bastin et al., 2000b). We examined a large number of cross sections of flagella from wild-type and several RNAi motility mutants (Branche et al., 2006) and noticed the frequent presence of granule-like structures with a diameter of 20–30 nm (Figure 4, A–F, and Supplemental Figure S3). Usually, only one particle is visible per section (Figure 4, A and C) but in rare instances (<5%), several particles can be seen on the same section (Figure 4B). Remarkably, particles show a very specific location relative to the axoneme doublets (Figure 4D): they are either associated to doublets 3–4 (Figure 4A) or 7–8 (Figure 4C), but they are never found next to doublets 5–6, doublet 9, and rarely close to doublets 1 and 2 (Figure 4D). Longitudinal sections showed that the particles look like flat rafts with one side that is very close to the microtubules, and the other side that seems almost in contact with the flagellar membrane (Figure 4E). Presence of the IFT-like particles seems to position the flagellar membrane more closely toward the axonemal microtubules (Figure 4E).

Open in a separate window

Figure 4.

IFT particles in flagella of trypanosomes. (A–C) Cross sections through the flagella of wild-type (WT) trypanosomes (A and B) or PF16^RNAi (C) cells induced for 3 d. The presence of the PFR attached to the axoneme allows for unambiguous identification of individual doublets, shown by white numbers. IFT-like particles are indicated by black arrows. (D) Position of IFT-like particles relative to axoneme doublets on cross sections of WT, PF16^RNAi, or PF20^RNAi induced cells for 3 d (n = 42, 81, and 21, respectively). (E) Longitudinal section through an IFT-like particle. Note the closer positioning of the flagellar membrane at the particle position. (F) Cross section through both the old (bottom) and the new (top) flagella from a wild-type trypanosome revealing the presence of IFT-like particles in the old flagellum. (G) Cross section through the transition zone showing the 9 + 0 arrangement but without IFT-like particles. (H and I) Cross sections of flagella of WT trypanosomes close to the top of the flagellar pocket. Central pair and dynein arms are visible, but the PFR is not yet present. Abundant particular material can be recognized. (J and K) Cross section through flagella of wild-type or PF20^RNAi cells induced for 3 d after detergent removal of the membrane. IFT particles are less abundant in detergent-treated samples but can sometimes be recognized (arrow in K). (L) Abundance of IFT particles in cross sections of flagella from whole cells or detergent-extracted cytoskeletons of wild-type (n = 42 and 41, respectively), PF16^RNAi (n = 82 and 73, respectively) or PF20^RNAi (n = 21 and 74, respectively) cells induced for 3 d.

We also looked at flagellum sections of RNAi mutants where expression of two proteins of the central pair (PF16 or PF20) had been separately silenced, leading to inhibition of motility but without interfering with flagellum construction (Branche et al., 2006; Ralston et al., 2006). Similar particles are visible in these flagella (Figure 4C) although at a slightly lower frequency: 31% of sections for PF16^RNAi cells and 24% for PF20^RNAi cells instead of 57% for wild-type (Figure 4L). Nevertheless, they all show the preferential association to the same doublets as was found in wild-type cells (Figure 4D).

Because the new flagellum is always found in the same position relative to the old flagellum (Briggs et al., 2004b), it can be identified in the few sections where both flagella are clearly visible. This revealed that both flagella contain these particles (a clear example for the old flagellum is shown at Figure 4F). IFT-like particles are never recognized in the transition zone of the basal body, although some amorphous, relatively electron-dense, material is visible between the microtubule doublets and the membrane (Figure 4G). This was clearly different from the inside of the axoneme shaft that seems much more translucent (Figure 4G). The central pair and the dynein arms are already visible in flagellum sections close to the top of the flagellar pocket (as confirmed by the short diameter of the flagellar pocket lumen). The PFR is not yet present but a large amount of material is found around the microtubule doublets, sometimes resembling the granules identified above (Figure 4, H–I).

Detergent-treatment suppresses most of the IFT172, tagged IFT20 or GFP::IFT52 signal at the flagellum. To relate this result with granules seen by electron microscopy, wild-type, PF16^RNAi, or PF20^RNAi cells were treated with 1% Nonidet P-40. This procedure removes the cell membrane, but it ensures an excellent conservation of the whole trypanosome cytoskeleton for electron microscopy analysis, including the axoneme and the PFR (Sherwin and Gull, 1989). In these conditions, the frequency of IFT-like particles drops, with <10% of samples showing a possible remnant at the expected position on doublets 3–4 or 7–8 (Figure 4, J–L). This result shows that these granules display the same characteristics as the three IFT proteins studied above.

IFT Genes Are Necessary for Flagellum Construction

Expression of the trypanosome genes IFT122, IFT140 (complex A) and IFT20, IFT52, IFT55, IFT80, IFT88, IFT172 (complex B) was individually silenced by inducible RNAi in trypanosomes, and knockdown efficiency was controlled at the RNA level by semiquantitative RT-PCR (Supplemental Figure S4). In all cases, RNAi silencing led to the inhibition of new flagellum formation and to the emergence of apparently nonflagellated trypanosomes (Figure 5, A and B). However, the old flagellum is not depolymerized and remains present. Analysis of cells fixed at different stages of RNAi silencing followed by IFA staining using a mAb recognizing a major PFR protein (Figure 5, A and B) showed a mixture of different cell types: cells retaining the old flagellum, cells with a shorter flagellum and cells without PFR signal, that could correspond to cells with very short flagella missing the PFR or to nonflagellated cells (see below). Cells with shorter flagella exhibited a reduced cell size, with those without a visible flagellum being the shortest (Figure 5, A and B), in agreement with the central role of the flagellum in the definition of cell size (Kohl et al., 2003). Trypanosomes are difficult to synchronize reliably, meaning that RNAi induction is likely to have different effects according to the position of a cell in its cycle. Therefore, it is important to examine carefully cells throughout the induction. IFA with the anti-PFR was first used to score proportions of positive and negative cells during the course of RNAi silencing of IFT and genes (Figure 5, D and E). Significant differences were noted in the rate of emergence of nonflagellated cells. In complex A proteins, knockdown of IFT140 leads to faster emergence of nonflagellated cells compared with IFT122 (Figure 5D). Differences are also observed in the knockdown of RNA-encoding complex B proteins. For example, it takes only 30 h to obtain 50% of nonflagellated cells during silencing of IFT172, whereas it takes an extra 40 h to generate a similar result for IFT52 knockdown (Figure 5E). Hence, these differences in kinetics are not linked to genes encoding members of a specific complex. Inhibition of any of the IFT genes invariably leads to a growth arrest whose timing is correlated with the kinetics of emergence of nonflagellated cells (Figure 5, D and G and E and H, for proteins of complex A and B, respectively). For example, in complex A members, silencing of IFT140 rapidly produces a large number of nonflagellated cells and leads to a more premature growth arrest compared with IFT122^RNAi grown and induced in the same conditions (Figure 5G).

Open in a separate window

Figure 5.

RNAi silencing of IFT and PIFT genes inhibits new flagellum formation and results in growth arrest. Cell lines were grouped as mutants of genes encoding proteins of complex A (A, D, and G), B (B, E, and H) or PIFT (C, F, and I). (A–C) Fields of cells from the indicated cell lines that had been induced for 3 d were stained with the anti-PFR2 L8C4 antibody (green) and with DAPI (blue). A mixture of nonflagellated and flagellated cells was present in all situations. (D–F) Proportion of flagellated cells left in the culture of the indicated RNAi mutants during the course of induction of RNAi silencing. (G–I) Growth curves of induced (plain lines) and noninduced (discontinuous lines) cells from the indicated RNAi mutants.

These differences in kinetics could reflect variable efficiency of RNA destruction or different rates of protein turnover (or both). RT-PCR analysis was performed on total RNA extracted from cell lines noninduced or induced for up to 5 d. Abundance of each target RNA was normalized with a control unrelated mRNA (Supplemental Figure S4). Kinetics of RNA silencing is very reproducible for all RNAi cell lines investigated: a potent silencing is observed 2 d after induction and a slight increase in the amount of the target RNA is noted the following days. This reproduces kinetic patterns observed for other RNAi cell lines developed in separate experiments (Durand-Dubief, Absalon, and Bastin, unpublished data). In summary, the differences in kinetics of emergence of nonflagellated cells during the course of RNAi are not due to a variable efficiency of RNA degradation, but they are likely to reflect differences at the protein level.

Distinct Phenotype upon Silencing of Genes Required for Anterograde or Retrograde Transport

In Chlamydomonas and C. elegans, inhibition of proteins associated to anterograde transport (IFT B and kinesin II complexes) leads to complete or severe inhibition of flagella or cilia formation. By contrast, blocking of retrograde transport (IFTA and dynein complexes) produces short cilia or flagella, filled with IFT material that can penetrate the flagellar compartment but cannot be recycled to the base (Cole, 2003). We analyzed IFT88^RNAi (mutant of a complex B protein) and IFT140^RNAi (mutant of a complex A protein) induced cells by double staining with the anti-IFT172 antiserum as a marker of the IFT particles and with the MAb25 antibody as a marker of the axoneme (Figure 6, A and C, and E). In IFT88^RNAi, the majority of short cells did not exhibit a flagellum (no MAb25 signal) and only showed a weak signal for IFT172, indicating that absence of IFT88 severely blocks flagellum formation and leads to a reduction or a dispersion of IFT172 (Figure 6A, stars, and C). This result was supported by scanning electron microscopy that revealed that most short cells did not exhibit a flagellum. In the rare cases where a flagellum could be detected, it often seemed short (<1 μm) and thin (Figure 6D). Cells that retained the old flagellum were still positive for both the MAb25 axoneme marker and the anti-IFT172, no matter the length of the flagellum (Figure 6A, arrows for long flagellum and arrowheads for flagella of intermediate lengths). A very different result was obtained for the IFT140^RNAi cells stained with the same antibodies (Figure 6, B and E). Numerous short cells were seen with a short line as MAb25 signal, indicating formation of a short axoneme, and with a very intense signal for IFT172 (Figure 6, B and E). The presence of short flagella filled with IFT172 proteins, producing very bright spots of fluorescence, increased rapidly during the course of RNAi silencing, whereas it was virtually never detected in the case of IFT88^RNAi (Figure 6G). Scanning electron microscopy demonstrated the presence of cells with short flagella (1–3 μm) with large dilations (Figure 6F), that very likely results from the accumulation of IFT proteins. However, cells that retained an old flagellum of normal length still exhibited the usual MAb25 and anti-IFT172 signals (Figure 6B, arrows). By contrast, cells that possessed a flagellum of intermediate length (~5 μm) showed normal MAb25 signal but much increased abundance of IFT172 protein (Figure 6B, arrowhead).

Open in a separate window

Figure 6.

IFT proteins from complex A and B are required for flagellum formation but differ in function. (A and B) Fields of IFT88^RNAi (A) or IFT140^RNAi (B) cells induced for 3 d stained with the anti-IFT172 antiserum (green) and with the MAb25 axoneme marker (red). DNA was stained with DAPI (blue). Cells with a normal-length flagellum (arrows), with a short flagellum (arrowhead), or without visible flagellum (stars) are indicated. (C and D) IFT88^RNAi induced cells have a tiny or no flagellum. (E and F) IFT140^RNAi-induced cells exhibit short and dilated flagella accumulating a large amount of IFT172 protein. (C and E) Cells induced for 3 d and stained with the anti-IFT172 antiserum (green) and with MAb25 (red). DNA was stained with DAPI (blue). (D and F) Scanning electron micrographs. Bar, 1 μm. Inset shows a twofold magnification of the indicated area. (G) Quantification of the number of cells exhibiting accumulation of IFT172 as bright spots during the course of RNAi silencing in the indicated cell lines. (H). IFT140^RNAi cell induced for 3 d with a short new flagellum and an old flagellum. Only the new flagellum is too short, dilated and accumulates IFT172 protein. Cells were stained with the anti-IFT172 antiserum (green) and with DAPI (blue). Bar, 5 μm.

Although construction of the new flagellum is inhibited or strongly reduced, the old flagellum remains present and is still motile. We examined IFT140^RNAi cultures at early stages of RNAi, with special emphasis on cells that were binucleated, so at late stages of their cell cycle (Figure 6H). The mature flagellum was normal and exhibited the expected signal for the anti-IFT172 antiserum whereas the new flagellum was very short and filled with IFT172 protein. This shows that the old and the new flagellum are independent from each other and despite the arrest of new IFT140 production, IFT140 protein present in the old flagellum is still functional. The ultrastructure of the old flagellum of IFT88^RNAi and IFT172^RNAi (anterograde transport mutants) and DHC1b^RNAi (retrograde transport mutant) was examined by transmission electron microscopy. Induction times were selected in such a way that cells were at a stage when they had stopped constructing a new flagellum, so that almost all flagellar sections should correspond to the old flagellum. This was carried out on whole cells and detergent-extracted cytoskeletons (Supplemental Figure S3). Sections through flagella were less frequent on induced cells compared with wild-type or noninduced controls, as expected from the drop in the proportion of flagellated cells upon RNAi induction. However, the ultrastructure of the axoneme seemed intact: the nine doublets microtubules, the central pair, the dynein arms and radial spokes were all present (Supplemental Figure S3). Their flagellar pocket also seemed structurally normal, as well as the flagellum adhesion zone (Supplemental Figure S3). Importantly, IFT particles are still visible on the old flagellum (Supplemental Figure S3). We observed IFT-like particles on six of 19 such profiles, i.e., a proportion similar to that observed for populations of cells that build their flagellum normally, indicating that IFT particles remain present in the old flagellum. This is confirmed by IFA with the anti-IFT172 that still stains the old flagellum of IFT140^RNAi (Figure 6H), IFT88^RNAi and DHC1b^RNAi (data not shown) cells induced for 2 or 3 d, indicating a slow turnover of IFT proteins in mature flagella.

Transmission electron microscopy was used to examine the new flagellum in control wild-type cells or IFT88^RNAi and DHC1b^RNAi cells (Figure 7). The basal body is rooted within the cell body, whereas the transition zone is covered by the flagellum membrane and localized in the lumen of the flagellar pocket of wild-type cells (Figure 7A). The flagellar pocket exhibits a typical asymmetric structure with the larger lumen side found at the anterior end. When a new flagellum is assembled, it is made in the same flagellar pocket (Grassé, 1961) found on the large, anterior, side of the lumen (Figure 7B, arrow). The transition zone is clearly recognizable and a mass of amorphous material is found at the distal growing end (Figure 7, B and C), wrapped by the flagellum membrane that sometimes seems distorted (Figure 7B). The basal bodies of such flagella are “bald”, i.e., axoneme microtubules have not yet elongated. These basal bodies seem shorter, suggesting that they have not fully matured yet. This was encountered in five of the 72 analyzed sections of the flagellar pocket (7%) (Table 1). The new flagellum grows and axoneme microtubules are now visible in continuity with those of the transition zone. Nevertheless, this new flagellum remains in the same flagellar pocket as the old flagellum (Figure 7D). In nonsynchronous cultures of wild-trypanosomes, 16% of flagellar pockets contain two flagella (n = 72). Finally, two individual flagellar pockets are visible, each containing a single flagellum (Figure 7E).

Open in a separate window

Figure 7.

Formation of the new flagellum in wild type cells and its inhibition in IFT^RNAi cell lines. Sections through the flagellar pocket of WT (A–E) or IFT172^RNAi cells induced for 48 h (F) or of IFT88^RNAi (G) or DHC1b^RNAi (H and I) induced for 72 h. Notice the large amount of material only in very short flagella of wild-type cells (B and C). The arrow in B indicates the new flagellum. The new flagellum grows in the same flagellar pocket as the old flagellum (B and D) and elongates until two separate flagellar pockets are recognized (E). Bald basal bodies (F and G) were frequent in sections of induced IFT172^RNAi and IFT88^RNAi mutants whereas short flagella and accumulation of IFT material was common in DHC1b^RNAi induced cells (H and I). Bars, 500 nm except where indicated.

Ultrastructure of the basal body and the flagellum was analyzed in IFT88^RNAi, IFT172^RNAi (mutants of anterograde transport), and DHC1b^RNAi (mutant of retrograde transport) cells at induction times where assembly of the new flagellum is drastically reduced (Figure 7, F–I). Longitudinal sections through basal bodies were grouped in three categories: those where axonemal microtubules are visible in direct continuity of the transition zone and seem normal, those where axonemal microtubules are present but interrupted, and those where only a bald basal body is visible (Table 1). In all IFT^RNAi mutants analyzed, the frequency of bald basal bodies rose significantly reaching close to 80% in the IFT88^RNAi cell line (Table 1). Some material is frequently detected on top of the basal body and looks like flagellar membrane extension (see below), but it does not resemble to what was observed for wild-type flagella (compare Figure 7F with B and C). The proximal region of all basal bodies still exhibits triplet microtubules, and the transition zone looks apparently normal. Nevertheless, these basal bodies seem slightly shorter, like the basal bodies of short new flagella in wild-type cells (Figure 7, B and C). These data demonstrate that axoneme formation is strongly inhibited in the absence of a protein of the IFT B complex. In the case of DHC1b^RNAi cells, about half of the sections revealed the presence of a bald basal body but other situations were encountered. Large accumulation of electron-dense material resembling IFT particles was observed (Figure 7H). Moreover, several sections showed the presence of short microtubules and some material trapped between this axoneme and the tip of the flagellar membrane (Figure 7I). In these situations, the basal body displayed a normal length. This accumulation fits with the dilation of short flagella of retrograde transport mutants observed by scanning electron microscopy and by IFA with the anti-IFT172 antiserum (Figure 6).

We conclude that in the absence of retrograde transport, members of the IFT complex B can still access the flagellum and accumulate there as they cannot be recycled due to the absence of retrograde activity. This would allow the formation of short and dilated flagella. Conversely, in the absence of anterograde transport, entry of IFT protein in the flagellum is restricted and flagellum formation is more strongly inhibited.

PIFT Genes Are Required for Flagellum Construction and Can Be Classified as Involved in Anterograde or Retrograde Transport

Expression of PIFT genes was knock downed by RNAi, it was monitored in parallel to the mutants of conventional IFT genes, revealing that all five selected PIFT genes were required for flagellum formation (Figure 5, C and F). Significant differences were also observed in the emergence of nonflagellated cells (Figure 5F), with fast phenotypes for silencing of PIFTA1, PIFTB2 or PIFTC3 (50% nonflagellated cells in 48–60 h), and the slower kinetics for PIFTF6 knockdown (50% of nonflagellated cells after 120 h of induction) and PIFTD4 (3–5% of nonflagellated cells after 120–240 h of induction; data not shown). These differences correlated with the timing of growth arrest (Figure 5I; see Supplemental Figure S5, A and B, for PIFTF6^RNAi), as observed in the case of silencing conventional IFT genes (Figure 5, G and H).

To evaluate the participation of these novel genes in IFT, IFA staining with the anti-IFT172 was performed on the five PIFT^RNAi cell lines (Figure 8 and Supplemental Figure S6). Flagellum presence and IFT172 signal were drastically reduced in PIFTA1^RNAi, PIFTB2^RNAi, and PIFTC3^RNAi. In the latter case, an increase of the cytoplasmic signal was consistently observed, indicating a possible redistribution of IFT172 in the cytoplasm (Figure 8B). In contrast, cells with short flagella brightly stained by the anti-IFT172 antiserum were abundant in PIFTD4^RNAi and PIFTF6^RNAi induced cells. Quantification of the proportion of short cells with bright, weak or no IFT172 signal was performed on all five PIFT^RNAi cell lines and revealed that PIFTA1^RNAi, PIFTB2^RNAi and PIFTC3^RNAi behave similarly to IFT88^RNAi (complex B), whereas PIFTD4^RNAi and PIFTF6^RNAi behave similarly to IFT140^RNAi (complex A) (Figure 8D). Scanning electron microscopy demonstrated that when visible, short flagella of PIFTA1^RNAi were smaller and thinner compared with those from PIFTD4^RNAi or PIFTF6^RNAi (Supplemental Figure S6). These results support the hypothesis that PIFTA1, PIFTB2, and PIFTC3 proteins are involved in anterograde transport whereas PIFTD4 and PIFTF6 are involved in retrograde transport.

Open in a separate window

Figure 8.

PIFT are involved in anterograde or retrograde transport. PIFTB2^RNAi (A) and PIFTC3^RNAi (B) induced for 3 d and PIFTD4^RNAi (C) induced for 5 d were stained with the anti-IFT172 antiserum. (D) Proportion of short cells displaying no, weak or bright signal with the anti-IFT172 antiserum (n ≥ 100). Bar, 5 μm.

PIFT Proteins Are Required for Flagellum Formation

The five PIFT genes identified by comparative genomics all turned out to be essential for flagellum formation, indicating the usefulness of this approach, also applied to identify genes involved in flagellum beating (Baron et al., 2007). The PIFT proteins are likely linked to anterograde or retrograde transport, as reported recently for the corresponding genes in C. elegans (Blacque et al., 2005, 2006; Murayama et al., 2005; Efimenko et al., 2006). These genes are conserved in Chlamydomonas, but their encoded proteins are not purified with IFT particles. This could be explained by a lower stoichiometry in the IFT particle or a weaker association that could be disrupted during purification. Alternatively, PIFT proteins could function in assembly or remodeling of the IFT particle without being a structural component per se.

We thank M. Bonhivers and D. R. Robinson (University of Bordeaux, France) for providing antibodies before publication and for numerous discussions; A. Estevez (Instituto de Parasitologia y Biomedicina Lopez-Neyra, Spain) for advise on the tap-tag system; J. Beisson (Centre de Génétique Moleculaire, France), G. Cross (Rockefeller University, New York, NY), P. Englund (Johns Hopkins School of Medicine, Baltimore, MD), K. Gull (University of Oxford, Oxford, United Kingdom), P. Michels (Christian de Duve Institute of Cellular Pathology, Belgium), and H. Nakhasi (Food and Drug Administration, Bethesda, MD) for providing trypanosome cell line, plasmids, or various antibodies. We acknowledge the electron microscopy departments of the Muséum National d'Histoire Naturelle and of the Pasteur Institute for providing access to equipment, and the advise from M. C. Prévost, N. Cayet, and S. Guadagnini. This work was funded by the Centre National de la Recherche Scientifique, by a Programme Protéomique et Génie des Protéines (to D. Robinson and P.B.), an ACI grant in Development Biology, by a Groupement d'Intérêt Scientifique grant on rare genetic diseases (to P.B.) and by sanofi-aventis. S.A. was funded by a Ministère de la Recherche et de l'Enseignement, Fondation pour la Recherche Médicale, and Pasteur-Weizmann fellowships. D.J. is funded by Agence Nationale de la Recherche grant “Maladies Rares” and by a Roux fellowship.