DNA mutation analysis

Genomic DNA samples were amplified using Clontech Advantage PCR plates. Primers are available upon request. Genewiz, Inc. (Paramus, NJ) purified then directly sequenced PCR products. Data were analyzed using Sequencher (Gene Codes, MI).

Cell culture, transient transfection, and stable infection

Cell lines were obtained from ATCC (MD). Live cells and mRNA from HCT116, DLD-1, and their daughter cell lines (except Hke-3) were obtained from the UK; live Hke-3 cells were never obtained due to x-radiation during shipment. Chemicals used in studies included: Akt Inhibitor V, Triciribine, LY 294002 in Solution, JNK Inhibitor II in Solution, U0126, Akt Inhibitor VII, EGFR inhibitor, Phorbol-12-myristate-13-acetate (all from Calbiochem, Germany), and Rapamycin (Sigma, MO). Modified siRNA duplexes were purchased from Invitrogen.

Transfections were performed using Lipofectamine 2000 reagent (Invitrogen, CA). Polyclonal pools of stable cell lines were generated by retroviral infection of pBabe-Ctrl, pBabe-KLF6, and pBabe-SV1 plasmids. Infected cells were selected with 2 μg/mL of puromycin. For each construct, at least two independent polyclonal pools of stable cell lines were generated and analyzed.

Analysis of proliferation

Proliferation was determined as previously described²¹. Proliferation was determined by assaying [³H]-thymidine incorporation. Cells were plated at a density of 50,000 cells per well in 12-well dishes. At appropriate time points after plating, 1 μCi/mL [³H]-thymidine (Amersham, Piscataway, NJ) was added. After 2 hours, cells were washed three times with ice-cold PBS and fixed in methanol for 30 minutes at 4°C. After methanol removal and cell drying, cells were solubilized in 0.25% sodium hydroxide/0.25% SDS. Following neutralization with hydrochloric acid (1 N), disintegrations per minute were estimated by liquid scintillation counting.

RNA and quantitative real-time PCR analysis

RNA from cell lines and tumors was extracted using the RNeasy Mini and Midi kit (Qiagen, CA). RNA was treated with DNase (Roche, Switzerland). One μg of total RNA was reverse-transcribed per reaction using first-strand complementary DNA synthesis with random primers (Clontech, Carpenteria, CA). Quantitative real-time PCR was done on a Roche LightCycler 480. Experiments were performed in triplicate three independent times. All values were normalized to GAPDH and β-actin. KLF6 primer sequences and protocols have been previously described^25–28;

KRas-F – GCTGGTGGCGTAGGCAAGAG

KRas-R – CTCCTCTTGACCTGCTGTGTCG

HRas-F – AGGAGACCCTGTAGGAGGA

HRas-R – CGCTAGGCTCACCTCTATAGTG

PI3K-F – CTGTGTGGGACTTATTGAGGTGGTGC

PI3K-R – GGCATGCTGTCGAATAGCTAGATAAGC.

Statistical significance was determined by ANOVA.

Protein Extracts and Western Blots

Cells were lysed in Lysis M (Roche) buffer, and lysates were sonicated and pelleted. Supernatants were denatured, and 30 μg of protein was separated by PAGE (Invitrogen), then transferred to nitrocellulose membranes (Invitrogen). The following antibodies were used: Akt (Cell Signaling, MA), phospho-Akt (Cell Signaling), β-actin (Santa Cruz, CA), and secondary anti-goat (Santa Cruz) and -rabbit (Amersham) antibodies. ECL images were analyzed and quantified with a BIOQUANT NOVA. Values were normalized to control and expressed as relative fold changes.

KLF6 Alternative Splicing is Regulated by Ras Signaling

To further elucidate the signaling cascades that regulate KLF6 alternative splicing, several cell lines were incubated with TPA (phorbol myristate acetate), a potent and immediate activator of Protein Kinase C (PKC), Ras, and its downstream effectors, the MAP kinases and PI3-K. Addition of TPA to the 293T human fibroblast cell line, which expresses wild-type Ras, significantly increased KLF6 SV1 mRNA at 24 hrs, as determined by splice form-specific real-time qPCR (Fig 1A). KLF6 alternative splicing increased as early as 3 hours after TPA treatment (data not shown). These results were verified using standard RT-PCR and agarose gel electrophoresis (data not shown). In PC3M cells, a metastatic prostate cancer line with constitutively active Ras signaling, KLF6 SV1 mRNA was also significantly increased by TPA, but to a much lesser extent (Fig 1A). Specifically, compared to 293T cells, PC3M cells, which are known to harbor highly increased Ras signaling, displayed elevated baseline levels of KLF6 SV1 mRNA (data not shown) suggesting that Ras–dependent splicing may already be activated in this line. Similar to 293T cells, increases in SV1 mRNA following TPA treatment were also observed in the human HCC cell lines Hep3B and Huh7, as well as the human hepatoblastoma cell line HepG2 (Fig 1B).

Open in a separate window

Open in a separate window

Figure 1

Oncogenic Ras signaling increases KLF6 alternative splicing. A–B) 293T, PC3M, Hep3B, Huh7, and HepG2 cells were plated at sub-confluent densities, treated with 40 ng/ml TPA (PMA) for 24 hours, then harvested for mRNA and protein. DMSO solvent served as vehicle control. All KLF6Full and KLF6 SV1 data are expressed as a fold change (ratio) of the experimental condition compared to vehicle control. For all western blots, densitography values are shown beneath each condition. C–D) Hep3B, Huh7, and HepG2 cells were treated with 40 ng/ml TPA and/or 100 μM FTS for 24 hours, then harvested for mRNA and protein. E) 293T & Hep3B cells were treated as in A–B. F–G) Hep3B, Huh7, & HepG2 cells were treated with 100 μM FTS, then harvested for mRNA and protein.

We next examined whether FTS, a farnesyl-transferase inhibitor (FTI) that prevents Ras proteins from localizing to the inner cell membrane, and hence prevents signal transduction³², blocked TPA-induced KLF6 alternative splicing. Indeed, when the cell lines Hep3B, Huh7, and HepG2 were incubated with TPA and FTS together, there were no significant changes in KLF6Full or SV1 expression (Fig 1C), suggesting that Ras signaling was necessary during TPA-induced KLF6 splicing. Furthermore, western analyses of these experiments (Fig 1D) confirmed Ras-dependent Akt phosphorylation in this cellular context, validating the use of p-Akt as a marker of Ras-activity. These results also implicated Ras-dependent Akt as a potential KLF6 splicing regulator, a hypothesis we tested below.

Activated Ras signaling and Ras-dependent Akt phosphorylation for the experiments in Figures 1A and 1B were confirmed by increased phosphorylation of Akt in 293T and Hep3B cell lines (Fig 1E, results are representative of all cell lines).

These findings supported the prospect that induction of Ras by TPA contributed to enhanced alternative splicing of KLF6 and generation of KLF6 SV1. To specifically address this possibility, 293T, BPH1 (a benign prostatic hyperplasia cell line characterized by an intermediate level of Ras signaling³⁹), and PC3M cells were transiently transfected with an oncogenic H-Ras expression vector, and expression of KLF6 SV1 was quantified. H-Ras transfection significantly increased KLF6 SV1 mRNA in 293T and BPH1 cells, but not PC3M (Supplementary Fig 2A). Activated Ras signaling was confirmed by increased phospho-Akt in 293T cells (Supplementary Fig 2B). Interestingly, the expression pattern of KLF6 SV1 in these cells parallels the relative activity of Ras. For example, in PC3M cells, where Ras signaling is constitutively active, ectopic expression of oncogenic Ras did not further increase KLF6 SV1 mRNA (Supplementary Fig 2A).

We next explored the potential role of K-Ras in KLF6 alternative splicing, since this Ras isoform is expressed more ubiquitously than H-Ras in human tissues. Similar to experiments with H-Ras, transient transfection of oncogenic K-Ras into BPH1 and PC3M cells resulted in significantly increased KLF6 SV1 mRNA only in BPH1 cells (Supplementary Fig 2C), indicating that splicing was enhanced by Ras, but primarily in cells not already expressing an activated isoform.

To further link Ras to KLF6 alternative splicing, cells were incubated with FTS. Incubation of Hep3B, Huh7, and HepG2 cells with FTI significantly decreased KLF6 SV1 mRNA in all three lines, while KLF6Full mRNA expression remained unchanged (Fig 1F upper panel). FTS-mediated inhibition of Ras signaling was confirmed by decreased phospho-Akt in Huh7 and HepG2 cells (Fig 1F, lower panel).

Deletion of Endogenous Oncogenic Ras Decreases KLF6 Alternative Splicing

Rather than relying solely on exogenous manipulation of human cancer cell lines, we employed a somatic cell system using two sublines of HCT116 (Hkh-2 and Hke-3) and DLD-1 (Dko-4 and Dks-8) colon cancer cells in which one K-Ras allele has been genetically deleted through homologous recombination. The Hkh-2 and Hke-3 lines express ~50% of the levels of K-Ras mRNA expressed by their wild-type counterpart (Supplementary Fig 3A), consistent with loss of heterozygosity for K-Ras. Hkh-2, Dko-4, and Dks-8 daughter cell lines contain less phospho-Akt than their normal counterparts (Supplementary Fig 3B), confirming attenuated Ras signaling. As predicted, these cells with deletion of one oncogenic K-Ras allele expressed significantly less KLF6 SV1 mRNA (Fig 2A). Reconstitution of K-Ras via transient transfection in Hkh-2 daughter cells significantly induced SV1 expression compared to the parental HCT116 line, without affecting KLF6Full (Fig 2B). Increased levels of p-Akt confirmed that Ras activity was increased following K-Ras transfection (Fig 2C). Conversely, when K-Ras expression was knocked down by siRNA⁴⁰ in Hkh-2, Dko-4, & Dks-8 cell lines (Supplementary Fig 3C), KLF6 SV1 mRNA, but not KLF6Full, was significantly decreased in all three lines (Fig 2D, relative expression of each isoform in the presence of siK-Ras vs siLuc), suggesting that elimination of Ras signaling largely abrogated alternative splicing of KLF6.

Open in a separate window

Figure 2

Abrogation of oncogenic Ras signaling decreases KLF6 alternative splicing. A) mRNA from HCT116 cells and the two daughter cell lines, Hkh-2 and Hke-3, were analyzed by qRT-PCR. B-C) HCT116 cells were transfected with control plasmid, Hkh-2 cells were transfected with 1 μg pcDNA-K-Ras, and mRNA and protein were analyzed. Data are normalized to their respective empty-vector controls. D) Hkh-2, Dko-4, and Dks-8 cell lines were plated at 50,000 cells per well, transiently transfected with either 1 μg of pSuper-Luc control vector or pSuper-K-Ras siRNA vector for 48 hours, then harvested for mRNA.

Reconstitution of KLF6 SV1 Restores a Ras-Transformed Phenotype

Similar to earlier results in prostate cancer cell lines²⁶, stable over-expression of KLF6 in DLD-1 colon cancer cell lines resulted in significant growth inhibition (Fig 3A). Conversely, when KLF6 SV1 was stably over-expressed in HCT116 cells, their respective growth rates were significantly increased (Fig 3B). However, stable SV1 over-expression in Hkh-2 cells only partially restored the daughter cell line’s proliferative capacity compared to its parental counterpart, suggesting that, as expected, KLF6 SV1 is only partly responsible for Ras’s growth-promoting effects (data not shown).

Open in a separate window

Figure 3

KLF6 SV1 can partially restore decreased cellular proliferation caused by Ras inhibition. A) DLD-1 cells stably over-expressing pBabe control vector or pBabe-KLF6Full were plated at 25,000 cells per well and allowed to grow in media for 5 days. B) HCT116 stably over-expressing pBabe control vector or pBabe-KLF6 SV1 were plated at 25,000 cells per well and allowed to grow in media for 4 days. C) Hep3B cells were plated at 25,000 cells per well and treated with DMSO vehicle control or 100 μM FTS for 3 days. D) Hep3B cells stably over-expressing pBabe control vector or pBabe-KLF6 SV1 were plated at 50,000 cells per well, then treated with DMSO vehicle control or 100 μM FTS for 3 days. Proliferation assays were performed at daily intervals.

We next examined whether KLF6 SV1 could overcome the growth inhibition conferred by blocking Ras. As predicted, incubation of parental Hep3B, HepG2, and PC3M cells with the Ras inhibitor FTS led to significantly decreased proliferation for 72 hours (Fig 3C, Supplementary Fig 4A-B). Next, we chose a representative Hep3B cell line in which we stably over-expressed KLF6 SV1 then assayed for the effects of FTS treatment. Also as predicted, the Hep3B cells stably over-expressing SV1 grew faster than vector-expressing cells, and FTS treatment of empty vector-expressing Hep3B cells greatly reduced their proliferation rates (Fig 3D). However, in Hep3B cells stably transduced with KLF6 SV1, the FTS-mediated reduction in growth rate was partially abrogated (Fig 3D).

In Hep3B cells stably over-expressing SV1, there was no change in KLF6Full expression while SV1 mRNA was increased approximately 12 fold (Supplementary Fig 4C). In the empty-vector transduced Hep3B cells treated with FTS, KLF6 SV1 was significantly decreased (Supplementary Fig 4D), mirroring previous results.

The PI3-K/Akt Pathway Downstream of Ras Signaling Regulates KLF6 Alternative Splicing

Ras proteins transduce their signals through two major kinase cascades, the MAP kinases and PI3-K. Incubation of 293T, BPH1, PC3M, as well as liver cancer lines (Hep3B, Huh7, and HepG2) with MAP kinase inhibitors did not significantly affect KLF6 alternative splicing (data not shown). However, transient over-expression of a dominant negative PI3-K construct³³ in PC3M cells significantly decreased SV1 mRNA (Supplementary Fig 5A). Moreover, when Hep3B, Huh7, and HepG2 cells were treated with the PI3-K small molecule inhibitor, LY294002, KLF6 SV1 mRNA was significantly decreased in all three lines (Fig 4A). PI3-K activity was maximally inhibited in HepG2 cells, as depicted by the absence of phospho-Akt upon LY294002 treatment (Supplementary Fig 5B). Because Akt/PKB and mTOR are downstream effectors of PI3-K signaling, we predicted that inhibition of these proteins would result in decreased KLF6 SV1 mRNA. Indeed, the Akt inhibitor, Triciribine, and the mTOR inhibitor, rapamycin, both significantly reduced SV1 expression (Fig 4B-C). Finally, because EGFR tyrosine kinase is among the most potent signals that activate Ras, the effect of EGFR inhibition on KLF6 splicing was assessed. Inhibition of this receptor reduced KLF6 SV1 mRNA expression (Fig 4D).

Open in a separate window

Open in a separate window

Figure 4

PI3-K/Akt signaling to ASF/SF2 regulates KLF6 alternative splicing. A) Hep3B, Huh7, and HepG2 cells were plated at 50,000 cells per well, treated with 10 μM LY294002 or vehicle control for 24 hours, then harvested for mRNA. B) PC3M and Huh7 cells were treated with 100 μM Triciribine or vehicle control for 24 hours, then harvested for mRNA. C) Hep3B and Huh7 cells were treated with 25 nM rapamycin or vehicle control for 24 hours, then harvested for mRNA. D) HepG2 and PC3M cells were treated with 2.5 μM EGF Receptor inhibitor or vehicle control, then harvested for mRNA. E) Hep3B, Huh7, and HepG2 cells were transfected with 5 nM control siRNA, ASF/SF2 siRNA, or 9G8 siRNA for 48 hours, then harvested for mRNA. F) Hep3B, Huh7, and HepG2 cells were transfected with 1 μg of ASF/SF2 or control plasmid for 24 hours and/or treated with 40 ng/ml TPA or vehicle control, then analyzed for mRNA.

Recently, Akt has been shown to directly phosphorylate and activate both the ASF/SF2 and 9G8 splice regulator proteins³⁴. Combined with our data suggesting Akt-mediated regulation of KLF6 alternative splicing, we examined whether either of these molecules contributed to regulation of KLF6 alternative splicing. siRNA knockdown of ASF/SF2³⁴, but not 9G8³⁴ (data not shown), significantly increased KLF6 SV1 mRNA expression (Fig 4E, Supplementary Fig 5C), suggesting that this splice protein regulates KLF6 alternative splicing. Finally, although ectopic overexpression of ASF/SF2 alone in liver cancer cell lines did not alter KLF6 alternative splicing, exogenous ASF/SF2 partly reduced TPA-induced expression of SV1 (Fig 4F, Supplementary Fig 5D).

Grant Support: SY, Howard Hughes Medical Institute Medical Student Research Fellowship; SLF, NIH Grants DK37340 and DK56621, Dept of Defense DAMD17-03-1-0100; XZ, Howard Hughes Medical Institute Medical Student Research Fellowship; JAM, NCI-RO1-CA122332; JML, NIDDK 1R01DK076986-01, I+D Program Spain (SAF-2007-61898), Samuel Waxman Cancer Research Foundation; AV, Fundacion Pedro Barrie de la Maza and a recipient of a National Cancer Center Fellowship

We thank: A. Chan of Mount Sinai School of Medicine, New York, NY, for the DN PI3-K, H-Ras^R12, and K-Ras^V12 constructs; M. Schwartz (Mount Sinai), J. Bruix (BCLC group-Hospital Clinic) and V. Mazzaferro (National Cancer Institute, Milan) for providing HCC samples; A. Dhillon of Beatson Institute for Cancer Research, United Kingdom, for the HCT116 cell lines (Hkh-2 and Hke-3) and DLD-1 cell lines (Dko-4 and Dks-8); Y. Kloog of Tel-Aviv University and S. Reif of Souraski Medical Center, Israel, for the FTS.