Abstract

Introduction

The ability of T lymphocytes to mount an immune response against a diverse array of pathogens is primarily conveyed by the amino acid sequence of the hypervariable complementary determining region 3 (CDR3) regions of the T cell receptor (TCR). The genes that encode the two primary types of TCRs, αβ and γδ, undergo somatic rearrangement during T cell development. TCRβ and TCRδ genes are assembled via recombination of Variable (V), Diversity (D), and Joining (J) gene segments (VDJ recombination) and similarly, the TCRα and TCRγ genes by recombination of Variable and Joining gene segments (VJ recombination) to form productive αβ and γδ Y-like surface receptors.

The selection, function, and diversity of αβ T cells have been extensively studied. In the thymus (1), αβ T cells are both positively and negatively selected. Once selected, αβ T cells are activated when they recognize and bind non-self peptides that are in a protein complex with HLA and displayed on antigen presenting cells (APC). Due to the combinatorial diversity of αβ TCRs, the adaptive immune system has the potential to recognize an enormous number of antigens. Estimates based on direct sequencing of TCRβ chains indicate that at any one time, an individual carries over 3 million unique TCRβ CDR3 chains (2).

γδ TCRs were discovered four years after αβ TCRs (3, 4) and were predicted to have a different role in T-cell ontogeny based on significant differences in γδ TCR diversity, selection, and distribution (5). While significant discoveries have advanced the field, important basic questions about γδ T cell activation and function remain. Unlike αβ TCRs, γδ TCRs bind self antigens, leading many researchers to suggest that γδ T cells are not negatively selected in the thymus (6). Once the cells emigrate from the thymus, γδ TCRs can bind antigens independently of an HLA scaffold and APCs (7, 8). However, the role of the APC is still unclear; mounting evidence indicates APCs enhance the γδ T-cell response (9). The distribution of γδ T cells also differs substantially from αβ T cells: while αβ T cells are the predominant lymphocyte in the blood, γδ T cells are more common in mucosal tissue (10–12).

While only 5–10% of circulating T cells are γδ, in primates most of the circulating γδ T cells use the same Vγ and Vδ gene segments, Vγ9/Vδ2(13, 14). Following exposure to certain pathogens, including tuberculosis, leprosy, and malaria (13, 14), and tumor cells, including Daudi cells (15) T cells with Vγ9/Vδ2 chains expand rapidly. In some patients, this T-cell population (Vγ9/Vδ2) expands to over 50% of all circulating T cells (including αβ T cells) during bacterial infection (16). This immune response appears to be essential; the circulating γδ T-cell population in AIDS patients is depleted of Vγ9/Vδ2 type T cells, and the reduction of these T-cell types is associated with increased susceptibility to bacterial pathogens and lymphomas (17). Given that this γδ TCR chain type is the most common and responds to a variety of pathogens and tumors, circulating γδ T cells are often considered a bridge between the innate and adaptive immune system (16).

Both αβ and γδ T cells are derived from the same multi-potent precursor cells. These two types of T cells are defined by the expression of T-cell receptors (TCR) on their surface, which are either γδ or αβ heterodimers. The TCR variable regions do not rearrange simultaneously during T cell development; TCRδ rearranges first, followed by TCRγ and TCRβ. The TCRα locus rearranges last, after the surface expression of both pre-TCRα and TCRβ chains (18). The effect of TCR rearrangement and expression on γδ and αβ T-cell lineage commitment remains controversial (1, 19–23). The canonical model proposes that relative expression level of αβ and γδ surface receptors drives precursor T cells to differentiate into αβ or γδ T cells.

To study T cells in depth, we developed a method to sequence millions of TCRβ chains from genomic DNA in parallel from a single sample (24). This method was adapted to sequence TCRγ chains from genomic DNA and uses a multiplex set of PCR primers to simultaneously amplify each possible combination of V and J. In this study, we deeply sequence the TCRγ chains from three unrelated healthy people and elucidate the properties of the TCRγ repertoire. To explore the timing of T-cell differentiation into αβ and γδ T lineages, we sorted peripheral blood samples into αβ and γδ T cells and then sequenced TCRβ and TCRγ from both lineages. While the canonical model (22, 24) suggests that TCRβ rearrangement precedes lineage fate decisions, we find that γδ T cells have few (or possibly no) rearranged TCRβ genes, suggesting that cell fate decision are decided prior to TCRβ rearrangement. TCRγ genes are rearranged in most or all αβ T cells, consistent with the evidence that TCRγ rearranges before cell fate is determined.

Results

Utilizing a high-throughput sequencing methodology, we sequenced both TCRβ and TCRγ repertoires from sorted αβ and γδ T-cell subsets collected from three healthy people’s blood. The TCRγ and TCRβ CDR3 chains were sequenced from genomic DNA extracted from approximately 150,000 T cells for each sample. We over sample from the PCR pool and use redundancy to correct errors inherent to the PCR amplification and sequencing processes (25) (Table 1).

TCRγ sequences in γδ and αβ T cells

To assess the distribution of TCRγ CDR3 sequences in both γδ and αβ T cells, TCRγ chains were amplified from all samples using a multiplex PCR reaction and sequenced using the Illumina platform. A mean of 1.6 million TCRγ sequences were amplified from αβ T-cell samples and a mean of 3 million TCRγ sequences were amplified from γδ T-cell samples (Table 1). The overall diversity was dramatically different between γδ and αβ T cells: three-fold more unique TCRγ CDR3 sequences were amplified from αβ T cells than γδ T cells, with an average of 44799 and 15021, respectively (Table 1). The TCRγ repertoire of γδ T-cells was dominated by one clone, this most frequent TCRγ CDR3 sequence represented >45% of all amplified TCRγ sequences (Fig. 1A). In all three samples, this most abundant TCRγ CDR3 sequence (TGTGCCTTGTGGGAGGTGCAAGAGTTGGGCAAAA) used Vγ9 and JγP gene segments, and was nucleotide identical across the CDR3 region between individuals (Fig. 2). The majority of the remaining TCRγ sequences from γδ T cells also used the gene segments Vγ9 and JγP (Fig. 3A). The ten most common unique TCRγ sequences account for 80% of the total γδ T cells. The remaining sequences, which are too rare to have been observed with lower throughput technologies, encode a diverse set of sequences and differed substantially between individuals.

Open in a separate window

Fig. 1

Frequency of the 25 most common TCR sequences

For each sample we plot the proportion of productive sequences accounted for by the 25 most numerous productive TCR sequences.(1A) TCRγ chains amplified from γδ T cells and αβ T cells and (1B) TCRβ chains amplified from αβ T cells.

Open in a separate window

Fig. 2

Shared nucleotide identical TCRγ CDR3 sequences

Nine nucleotide identical TCRγ CDR3 sequences amplified from γδ T cells are shared by all three individuals. For each shared sequence, the copy count detected for each individual is indicated on the Y-axis.

Open in a separate window

Fig. 3

Average V-J gene utilization of sequenced TCRγ and TCRβ sequences across three samples

Average V-J utilization of gene segments in TCRγ CDR3 sequences amplified from γδ T cells (3A), TCRγ CDR3 sequences amplified from αβ T cells (3B), and TCRβ sequences amplified from αβ T cells (3C).

The TCRγ chains amplified from αβ T cells were more diverse than those from γδ cells. In the αβ T cells, no single TCRγ sequence represented more than 7% of the overall TCR population (Fig. 1B) and no single Vγ or Jγ gene segment dominated the repertoire (Fig. 3B). The majority of TCRγ sequences utilized only three of the nine Vγ segments, however the assay does capture all possible VJ combinations as detected by the VJ usage of unique out-of-frame TCRγ CDR3 sequences in αβ T cells (Fig. 4). Many TCRγ CDR3 sequences amplified from αβ T cells utilized Vγ10 gene segments, a gene segment predicted to have a non-consensus donor splice site in the first exon, resulting in the absence of splicing of the leader intron and termination of translation of the leader peptide (26, 27).

Open in a separate window

Fig. 4

Average copy number, by V-J pairing, of unique out-of-frame TCRγ sequences

Average copy number, by VJ gene segment usage, of unique out-of- frame TCRγ sequences amplified from αβ T cells.

Discussion

High throughput sequencing technology allows analysis of the TCRγ and TCRβ repertoire at an unprecedented depth. Both circulating αβ and γδ T cells carried rearranged TCRγ chains, and the productive to non-productive ratios suggest that, at least in γδ T cells, both alleles rearrange prior to thymic selection. While the TCRγ repertoire of αβ T cells contains no major clone, the majority of γδ T cells sampled from peripheral blood utilize an identical germline TCRγ rearrangement of Vγ9JγP gene segments that lack insertions at the V-J junction. However, 20% of the circulating TCRγ repertoire of γδ T-cells is diverse. This underlying diverse repertoire was virtually invisible with older detection methods (29). The predominant Vγ9JγP sequence in all γδ T cell samples is identical to a TCRγ receptor with well-studied binding affinities (30). While a few of the sequences from the remainder of the γδ T-cell repertoire have known functions, most have not been previously studied or observed (33, 34). The majority of γδ T cells did not carry a rearranged TCRβ chain, consistent with TCRβ rearranging after T cell lineage bifurcation. The distribution of TCRγ sequences in blood suggests that γδ T cells share qualities with both the innate and adaptive immune system, with universal sequences shared across individuals likely to perform innate functions, while the background repertoire of diversity may play a more adaptive role.

Most models of T-cell lineage decision assume that TCRδ, TCRγ, and TCRβ rearrange prior to T-cell fate commitment (22, 35, 36). However, the majority (>90%) of γδ T cells included in this study lacked a rearranged TCRβ chain. These results are consistent with a previous study that provided evidence that TCRβ chains rearrange after both TCRδ and TCRγ (18), and that TCRβ are not rearranged in γδ T cells (37). These results indicate that TCRβ rearranges after T-cell lineage bifurcation, and that successful TCR rearrangement is an unlikely lineage commitment signal.

However our data indicates that both TCRγ alleles rearrange in the majority of T cells, in agreement with the prior published data (38). Other evidence also suggests that TCRγ rearranges prior to the cell fate determination and, therefore, prior to thymic selection (18, 36). Given that TCRs rearrange prior to thymic selection, random insertions and deletions in the CDR3 region would result in approximately one-third in-frame and two-thirds out-of-frame rearrangements. In γδ T cells thymic selection then would skew this ratio, as a T cell must contain at least one productive TCR to survive and leave the thymus. Our data is consistent with both TCRγ alleles rearranging prior to selection. Since we only observe T cells after thymic selection, all γδ T cells with both TCRγ alleles rearranged out-of-frame would die in the thymus. Therefore, under this model, we expect to observe T cells with one in-frame TCRγ rearrangement with the other allele either in-frame or out-of-frame. With an expectation of two thirds of TCRγ rearrangements being out-of-frame, $\frac{2}{3}\ast \frac{2}{3}=\frac{4}{9}$ of all cells should fail to generate a productive TCRγ chain. Of the remaining $\frac{5}{9},\frac{4}{9}$ are estimated to have one in-frame and one out-of-frame allele. The final $\frac{1}{9}$ should have two in frame alleles. Therefore, the predicted ratio of in-frame to out-of-frame TCRγ chains in a pool of γδ T cells is predicted to be 3:2. In our data, the observed fraction of in frame TCRγ is 53.5+/−2.6. This suggests low-level negative selection; despite evidence that γδ T cells do not undergo antigen selection within the thymus (for a review see (6, 39)). If, on the other hand, the second allele only rearranges if the first allele is non-productive, we would expect an even higher ratio of in frame to out of frame TCRγ genes. An estimate is ⅓ of the cells have the first allele in frame. The other two thirds rearrange their second allele. So, ⅓ of the cells would have one in frame allele and $\frac{1}{3}\times \frac{1}{3}=\frac{2}{9}$ would have one in frame and one out of frame allele. The remaining cells would have two out of frame alleles and would be expected to die. The result is a ratio of 2:1 of in frame to out of frame. This is a far worse match to the observed data, and thus our data is consistent with both TCRγ alleles rearranging prior to thymic selection.

Strikingly, the most common TCRγ sequence does not have a corresponding in-frame or out-of-frame TCRγ sequence with similar copy count. This, and that the dominate clone lacks non-template insertions, suggests that the dominant clone developed under different circumstances than the underlying diverse array of γδ T cells. The lack of a corresponding sequence of similar copy count suggests either recombination was restricted to one allele or both alleles were restricted to the same rearrangement and the lack of insertions suggest that the terminal deoxynucleotidyl transferase (TdT) enzyme is not present during the rearrangement. Although indirect, this suggests that this dominant clone is formed very early in human development, likely a prenatal rearrangement prior to gestational week 20 when TdT is first expressed in the fetal thymus. This hypothesis has precedent; during mouse fetal development γδ T cells with determinate TCRs develop and home to specific tissues. While some work indicates that this TCRγ chain is not common in neonates (40), work by McVay and Carding found that this TCRγ chain was present in fetal livers at 11 weeks (41). Later work indicates that this population of γδ T cells develops extra-thymically in the fetal liver and primitive gut (42). This supports the hypothesis that the dominant clone is innate.

Several biologically important epitopes have been reported to bind γδ heterodimers with TCRγ chains amplified by this study. The most abundant TCRγ sequence chain in all three individuals is identical to a TCRγ CDR3 chain reported by Wang et al. to be part of a γδ heterodimer that reacts to a variety of nonpeptide prenyl phosphates including (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMBPP), and isopentenyl phosphate (IPP)(30). Non-peptide prenyl phosphates, metabolites common to all organisms, are associated with Vγ9/Vδ2 T-cell expansion (31). Some types are more reactive, like HMBPP, a metabolite of the 2-C-methyl-D-erythritol-4 phosphate pathway for isoprenoid biosynthesis that is more common in Eubacteria and some protozoa. This same TCRγ sequence is found in the TCRs of T cells that respond to Daudi Burkitt lymphoma cells (15, 32, 43) and Molt-4 tumor cells (29). In addition to the dominant sequence, multiple sequences amplified in this study were previously asserted by Chen et al. (2008) to bind epitopes displayed on the surface of SKOV3 tumor cells and HBV infected cells. These epitopes include human mutS homolog 2 (hMSH2) and heat shock protein (HSP) 60(33). Finally, a chain that uses Vγ8, CATWDTTG, that was present in two sampled individuals (Sample B and Sample C), is a public TCRγ chain that reacts with CMV and is expanded in infants infected with CMV (34). Given that the frequency of Vγ9/Vδ2 T-cells is positively correlated with natural repression of the HIV virus (44), and rapid expansion of this population is associated with rapid clearance of Tuberculosis in rhesus monkeys (13), the frequency of the major V9JP clone may be a useful biomarker.

For the analysis presented, we limited each sample to 250,000 haploid genomes due to the relatively small fraction of γδ T cells in human blood. However, the assay presented has the potential to sequence many millions of TCRγ chains. This depth of coverage readily allows detection of a TCR clone at one part in a 100,000 or even lower. All T cells appear to rearrange TCRγ, including αβ T cells, so this assay allows us to track clones with unprecedented sensitivity, and significant potential for clinical applications. Given the most common TCRγ clone has likely important biological functions, the clone’s frequency may be an important indicator of immune health and or immune response. In addition, given that TCRγ rearranges in both γδ and αβ T cells, TCRγ clones can be useful for tracking minimal residual disease in blood cancers. Given the technology we used in this paper, we can follow the clonal expansion and contraction for hundreds of thousands of T-cell clones over time.

Materials & Methods

References and Notes