Abstract

Introduction

Acute lymphoblastic leukemia (ALL) is a neoplastic disorder that is rapidly fatal if untreated. In children, considerable advances in ALL have resulted in most being cured of their disease. By contrast, the majority of adult patients with ALL are not cured, in part, due to an increased frequency of unfavorable genetic alterations (Mullighan and Downing, 2009). This severe malignancy presents great heterogeneity in genetic profiles, clinical features, response to treatment, and prognosis. The diversity of ALL results mainly from mutant genes that are causally implicated in the pathogenesis of the disease. The full complement of genetic alterations responsible for the pathogenesis of ALL is not yet known and has turned into a hotspot interesting many researchers. In recent decades, progress in understanding the molecular basis of the disease not only provides more clues to clarify the mechanism of leukemogenesis, but also allows a more detailed subclassification and more exact prognostic predictions in many patients. In general, BCR/ABL fusion, MLL-AF4 fusion, and hypodiploidy (<44 chromosomes per leukemic cell) all confer a poor outcome, whereas hyperdiploidy (>50 chromosomes), TEL-AML1 fusion, and trisomy 4, 10, and 17 are associated with favorable prognosis (Pui et al., 2008). In addition to predicting prognosis, these gene alterations provide the basis for more targeted, risk-adapted therapeutic approaches as well as the development of novel therapies (Pui et al., 2008). For example, the bcr-abl fusion kinase produced by the BCR-ABL fusion gene is a good target of imatinib (also called Gleevec) in treatment (Druker, 2004). γ-Secretase, a multicomponent membrane-associated enzyme, is needed for NOTCH1 signaling through mutant NOTCH receptors in T-cell acute lymphoblastic leukemia, providing an attractive target for therapeutic intervention with a newly developed γ-secretase inhibitor (Paganin and Ferrando, 2011).

Recently, the newly unraveled IDH mutation in leukemia brings one more focus in this field. Isocitrate dehydrogenase 1 (IDH1) is a cytosolic protein that catalyzes the NADP⁺-dependent carboxylation of isocitrate into α-ketoglutatrate. Recently, mutations at arginine 132 of IDH1 have been revealed in acute myeloid leukemia (AML) by genome-wide screening (Mardis et al., 2009). The IDH1 mutation occurred with a frequency of 4.4–9.6% in AML (Mardis et al., 2009; Boissel et al., 2010; Green et al., 2010; Ho et al., 2010; Zhang et al., 2011) and up to 16% in cytogenetically normal AML (Paschka et al., 2010). The mutation was demonstrated to be very stable during disease development and might be a potential marker for residual disease monitoring (Chou et al., 2010). Some reports demonstrated that the mutations implicate unfavorable outcome in distinct cytogenetic or genetic subgroups (Mardis et al., 2009; Abbas et al., 2010; Boissel et al., 2010; Green et al., 2010; Marcucci et al., 2010; Paschka et al., 2010), whereas in other studies, IDH1 mutations had no impact on prognosis (Chou et al., 2010; Wagner et al., 2010).

Isocitrate dehydrogenase 2 (IDH2) gene encodes a mitochondrial protein homologous to IDH1 and also catalyzes isocitrate carboxylation. Subsequent to the detection of the IDH1 mutation, mutations at arginine 140 and 172 of IDH2 were also detected in AML (Boissel et al., 2010; Marcucci et al., 2010). IDH2 mutations occurred with a frequency of up to 11% in AML (Abbas et al., 2010; Paschka et al., 2010; Patel et al., 2011; Zou et al., 2010) and were mutually exclusive with mutations in IDH1 (Marcucci et al., 2010). Some studies showed that the IDH2 mutation had no impact on the prognosis (Thol et al., 2010), whereas some other studies provided evidence that the mutation had an unfavorable impact on the complete remission rate and overall survival (Boissel et al., 2010; Marcucci et al. 2010).

In addition to AML, the IDH mutation was also found in a variety of hematologic malignancies, including myelodysplastic syndromes (Kosmider et al., 2010), myeloproliferative diseases (Pardanani et al., 2010; Tefferi et al., 2010), and non-Hodgkin lymphoma (Zou et al., 2010). So far, only a few IDH-mutated cases have been identified in ALL. Kang et al. (2009) reported one B-acute lymphoblastic leukemia (B-ALL) case with an IDH1 R132C mutation (1/60; 1.7%). Another single IDH1 mutation, also R132C, was detected in an analysis of 288 pediatric ALL samples by Andersson et al. (2011). Abbas et al. (2010) reported an ALL case with an IDH2 R140Q mutation (1/96; 1.0%). It seemed that the mutation was rare in ALL. With the aim to study the IDH status in ALL patients, we analyzed the IDH1/2 gene in 54 adult and 34 pediatric ALL patients.

Materials and Methods

Mutation analysis

The hotspot mutation at codon 132 of IDH1 was prescreened by polymerase chain reaction (PCR) and restriction endonuclease-based detection as previously described (Meyer et al., 2010; Zhang et al., 2011) and identified by sequencing confirmation. PCR amplification of a 166-bp fragment overriding codon 132 was carried out using forward primer 5′-TGGGTAAAACCTATCATCATCGT-3′ and reverse primer 5′-TTCATACCTTGCTTAATGGGTGT-3′. The last four nucleotides (CGAT) of the forward primer made up one part of the PvuI restriction site (CGATCG), and the first two nucleotides (CG) of the wild-type sequence of IDH1 R132 made up the other part of the PvuI restriction site. Consequently, the PCR product of the wild-type IDH1 carried a PvuI restriction site. If substitution mutation occurred in either of the first two nucleotides of IDH1 R132, then the PvuI restriction site would be destroyed. About 2μL of the PCR products was digested for 4h at 37°C using restriction endonuclease PvuI and appropriate buffer (New England Biolabs) in a total volume of 20μL. The sizes of the cleaved fragments were 142 and 24bp. Separation on 3% agarose gels allowed detection of the noncleaved fragment of 166bp and the larger cleaved fragment of 142bp, whereas the smaller cleaved fragment of 24bp was invisible. Complete restriction of the PCR product resulted in a single band of 142bp. Detection of only one signal of 142bp indicates that the patient carried two wild-type alleles of IDH1 (Fig. 1). Detection of two signals of 142 and 166bp indicates a heterozygote with one each of mutated and wild-type allele (Fig. 1). All mutations were determined consequently by cloning into a pMD18-T vector and sequencing (Fig. 2).

Open in a separate window

FIG. 1.

Prescreening of IDH1 R132 mutant by endonuclease digestion. M: DL2000; 1: polymerase chain reaction product without digestion; 2: patient 1; 3: patient 2; 4: patient 3 (the three patients were all heterozygous mutant); 5: wild type.

Open in a separate window

FIG. 2.

Sequences of IDH1 mutations. (A–C) The mutation types of patient 1, 2, and 3. The sequences in the frames were the mutated codon 132 of IDH1. The arrow indicates the single-mutated nucleotide.

For IDH2 mutational analysis, DNA fragments covering exon 4 were amplified using the primer pair IDH2F: AATTTTAGGACCCCCGTCTG/IDH2R: CTGCAGAGACAAGAGGATGG. The PCR product was directly sequenced as previously described (Marcucci et al., 2010).

Results

Three cases of IDH1-mutated ALL were identified in the total of 54 (5.5%) adult patients and no IDH1 mutation was detected in pediatric patients. No IDH2 mutation was identified in either the adult or the pediatric cases. The IDH1 mutation occurred in 5.3% (2/38) of adult B-ALL and 6.25% (1/16) of adult T-acute lymphoblastic leukemia (T-ALL). All the three mutants were heterozygous (Fig. 1). The mutation types were R132H (CGT>CAT; Fig. 2A), R132G (CGT>GGT; Fig. 2B), and R132S (CGT>AGT; Fig. 2C). The clinical characteristics of the three patients were described in Table 1.

Table 1.

Clinical Characteristics of the IDH1-Mutated Acute Lymphoblastic Leukemia Patients

	Patient 1	Patient 2	Patient 3
Sex	Female	Male	Male
Age (years)	44	15	53
Symptoms and signs	Metromenorrhagia, dizziness, fatigue, petechia, splenomegaly	Sore throat, fever, adenopathy of cervical lymph nodes, swelling of tonsils, hepatomegaly	Pale, fatigue, chest pain following exercise, paroxysmal throbbing headache
Diagnosis	Pro-B-ALL	Pre-T-ALL	Common-B-ALL
IDH1 R132 mutation type	CGT>CAT	CGT>GGT	CGT>AGT
WBC	325, 380/μL	1370/μL	2920/μL
Hg	80g/dL	84g/dL	58g/L
Plt	23,000/μL	117,000/μL	92,000/μL
Blast % in bone marrow	88%	80%	75%
Immunophenotype	CD19, CD22, CD38, cytTdT	cytCD3, CD7, CD8, cTdT, CD13, CD33, CD34, CD38, CD11b	CD19, CD10, CD79a, CD13, CD33, CD65, and HLA-DR
Karyotype	t(4;11)	Normal	Normal
Gene alteration	MLL/AF4	None	None
LDH (reference range 15,220U/L)	1134U/L	204U/L	286U/L
DFS (months)	6	3	4
OS (months)	18	4	7

Open in a separate window

IDH1, isocitrate dehydrogenase 1; WBC, white blood cell; Hg, hemoglobin; Plt, platelet; LDH, lactate dehydrogenase; DFS, disease-free survival; OS, overall survival; B-ALL, B-acute lymphoblastic leukemia; T-ALL, T-acute lymphoblastic leukemia.

Discussion

Researchers are focusing on IDH mutation since it has been demonstrated to be recurrent gene alteration in AML (Mardis et al., 2009). Subsequently, the mutation was also detected in myeloproliferative neoplasm (Pardanani et al., 2010; Tefferi et al., 2010), myelodysplastic syndrome (Kosmider et al., 2010), and non-Hodgkin lymphoma (Zou et al., 2010). Only three IDH-mutated cases were so far identified in ALL (Kang et al., 2009; Abbas et al., 2010; Andersson et al., 2011). Our observation confirmed the occurrence of IDH1 mutation in ALL. Based on this observation, we predict that additional IDH-mutated ALL cases will be reported in further studies and IDH mutation may be a recurrent gene alteration in ALL.

As for the method to detect the mutation, there are a multitude of means. The most popular method is direct sequencing (Abbas et al., 2010; Andersson et al., 2011). In addition, single-strand conformation polymorphism-based assays (Kang et al., 2009; Zou et al., 2010) and real-time PCR with post-PCR fluorescence melting curve analysis assays (Lin et al., 2011; Noordermeer et al., 2011) were also used. The immunohistochemistry with the anti-IDH1 R132H antibody (Kato et al., 2009; Byers et al., 2012) allows the observation of IDH1 R132H-positive cells in the clinical samples and leads to diffused staining by the antibody in almost every single cell of IDH1 R132H-positive tumor. The restriction digestion method is less expensive and simple. Direct sequencing is simple and fast. However, the limitation of these two methods is that DNA needs to be extracted from samples containing a high proportion of tumor cells, so that if the IDH1-mutated tumor cell load was low, then the mutated sample could not be screened out. Therefore, the sensitivity of these two methods is not satisfied. In comparison to DNA sequencing, the restriction digestion method is not applicable to detect other IDH1 mutations in exon 4 in addition to R132.

In our observation, two IDH1-mutated patients (patient 2 and 3) had normal karyotype and expressed the myeloid antigens CD13 and CD33. Interestingly, the pediatric IDH1-mutated case reported by Andersson et al. (2011) also had a normal karyotype and aberrant myeloid antigen expression of CD13 and CD33. The expression of the myeloid antigens in the IDH1 mutation carriers suggested that the leukemia clone of IDH1-mutated ALL may come from an early stage of hematopoiesis and IDH1 mutation may be involved in myeloid differentiation. In previous reports, the IDH1 mutation was demonstrated to be related to an increase of reactive oxygen species (ROS) (Kolker et al., 2002; Ward et al., 2010). It was speculated that the increase of ROS may disturb the quiescence of the hematopoietic stem cells (HSCs) and act as an intracellular trigger for HSC differentiation to the myeloid lineage fate (Tothova and Gilliland, 2007). The expression of myeloid antigens in IDH1-mutated ALL observed in our study supported this speculation, which could partially explain how the IDH1 mutation contributes to the transformation of HSCs.

In our observation, all of the three IDH1-mutated patients relapsed or died within 6 months. Although the limited number of mutation carriers allows no final conclusions regarding the prognostic impact of ALL, we speculated that the mutation may imply a dismal outcome. Large scope studies are needed to verify the prognostic significance of the mutation in ALL.

In summary, the IDH1 mutations may be a recurrent gene alteration in adult ALL (3/54, 5.5%). The mutations occur in both B-ALL (2/38, 5.3%) and T-ALL (1/16, 6.25%). The IDH1-mutated ALL patients may have a trend to carry normal karyotype and express myeloid antigen aberrantly. ALL patients harboring the mutation may have unfavorable prognosis. However, the limited number of the mutation carriers identified in this study warranted strong conclusions, and we are expecting further studies to clarify the role of IDH in ALL.

References