In vitro susceptibility testing.

Colistin MICs were determined by reference broth microdilution following the CLSI methodology (16) and were interpreted accordingly to the EUCAST guidelines (see http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/Breakpoint_table_v_4.0.pdf). Escherichia coli ATCC 25922 (colistin-susceptible) and K. pneumoniae KKBO-4 (colistin-resistant) (11) were used as quality control strains.

Whole-genome sequencing and sequence analysis.

Whole-genome sequencing (WGS) of KPB-1 and KPB-2 was performed at an external facility (IGA Technology Services, Udine, Italy), using the HiSeq2000 Illumina platform (Illumina Inc., San Diego, CA, USA) and a paired-end protocol with an average insert size of 350 bp. Reads were assembled into contigs using the ABySS de novo assembler (17), yielding 260 contigs for KPB-1 and 295 contigs for KPB-2, with N₅₀ (length-weighted median) values of 130,840 bp (KPB-1) and 133,427 bp (KPB-2), mean contig sizes of 34,400 bp (KPB-1) and 35,958 bp (KPB-2), maximum contig lengths of 501,165 bp (KPB-1) and 545,254 bp (KPB-2), and contig sums of 5,779,306 bp (KPB-1) and 5,825,236 bp (KPB-2). Sequence data were analyzed following the bioinformatics approach described previously (11).

Recombinant DNA methodology.

Genomic DNA was purified using a DNeasy blood and tissue kit (Qiagen GmbH, Hilden, Germany), and plasmid DNA was purified as reported previously (11). Restriction endonucleases were purchased from Promega (Madison, WI). Electroporation of plasmids into E. coli and K. pneumoniae was carried out as described previously (11). The plasmids pACYC-pmrB and pACYC-pmrB^T245G, which were used for complementation experiments, were derivatives of pACYC184 (18) containing the wild-type pmrB gene and the pmrB^T245G gene, respectively. These plasmids were constructed by amplification of the pmrB gene and flanking regions from strains KPB-1 and KPB-2, using the primers AvaI_pmrAB_F and EcoRI_pmrAB _R (Table 1 and Fig. 1). The resulting 1,834-bp PCR products, covering the complete pmrB gene with its putative terminator and part of the upstream pmrA gene, were digested with AvaI and EcoRI and cloned into pACYC184 digested with the same enzymes. The authenticity of the cloned fragments was confirmed by sequencing of both strands at an external sequencing facility (Macrogen Inc., Seoul, South Korea).

TABLE 1

Primers and PCR conditions used in this work

Assay type and primer	Sequence (5′ to 3′)a	Cycling conditionsb
Conventional PCR
AvaI_pmrAB_F	TCCCTCGGGTCATTACAGCCTGATCGTGCTGGATCTCG	95°C for 30 s, 62°C for 30 s, 72°C for 180 s
EcoRI_pmrAB _R	CCGGAATTCTCGTCCTGCTTGCCAGATAACAAACATTT
qRT-PCR
pmrA_F	GCAGGGGTTAATTCTGGCGATGC	95°C for 10 s, 52°C for 5 s, 72°C for 5 s
pmrA_R	CGATAGCGCGGCTTCGTGC
pmrB_F	GGCCGTCGTCTCTGGCGATG	95°C for 10 s, 52°C for 5 s, 72°C for 5 s
pmrB_R	GGGCTGTAGCGGTGAGCATTC
pmrK_F2	CGCTGAATATGCTCGACCCAGAAG	95°C for 10 s, 52°C for 5 s, 72°C for 5 s
pmrK_R2	GCTGGCGGTAATCGTCTGTACG
rpsL13_F	GCCGTACTTGGAGCGAGCCTG	95°C for 10 s, 52°C for 5 s, 72°C for 5 s
rpsL14_F	CCGTGGCGGTCGTGTTAAAGA

Open in a separate window

^aRestriction sites added for cloning purposes in some primers are underlined.

^bAll conventional PCRs included an initial denaturation step of 180 s at 95°C, 30 cycles of denaturation, annealing, and extension at the reported temperatures for the reported times, and a final extension step of 300 s at 72°C; all qRT-PCRs included an initial denaturation step of 300 s at 95°C and 40 cycles of amplification.

Open in a separate window

FIG 1

Organization of the pmrCAB operon and flanking regions in K. pneumoniae KPB-2 and location of the T245G mutation in the pmrB gene, leading to the L82R amino acid substitution in the transmembrane domain of the PmrB protein. The locations of primers used for PCR cloning of the pmrB gene for complementation experiments are indicated by thin black arrows. A, AvaI_pmrAB_F; E, EcoRI_pmrAB_R. In Salmonella enterica, the pmrC gene product catalyzes the addition of phosphoethanolamine to lipid A, which also could contribute to decreasing the negative charge of lipid A (14). The role of pmrC in K. pneumoniae has not been specifically reported, but given the conservation of pmrC and of the whole Pmr system, it likely retains the same function.

Quantitative real-time PCR for transcriptional analysis.

RNA extractions were performed using the SV total RNA isolation kit (Promega), and the corresponding cDNAs were obtained using the Improm-II reverse transcriptase kit (Promega). The relative levels of expression of the pmrA and pmrB genes of the pmrCAB operon and of pmrK (a member of the pmrHFIJKLM operon) were assessed by quantitative real-time PCR (qRT-PCR) using a LightCycler instrument (Roche Applied Science, Mannheim, Germany) and the primers and conditions reported in Table 1. Normalization was performed with the rpsL gene as an internal standard (11), using the ΔΔC_T method (19), and the values obtained were then normalized against the value obtained with the susceptible KPB-1 strain.

Stability of the colistin-resistant phenotype in strain KPB-2.

To assess the stability of the colistin-resistant phenotype, the KPB-2 strain was grown in the absence of antibiotic selection, in cation-adjusted Mueller-Hinton (MH) broth (bioMérieux, Florence, Italy), at 37°C aerobically (10 ml of culture medium in 50-ml flasks, in an orbital shaker operating at 180 rpm) for approximately 50 generations, by subculturing the strain (1:100 dilution) every day for 5 days. After this period, the culture was plated onto MH agar without antibiotic, to obtain individual colonies, and the proportion of colistin-resistant colonies was enumerated by replica plating onto selective medium (MH agar supplemented with 4 μg/ml of colistin; upon replica plating, the KPB-2 strain was found to be able to grow on MH agar containing this colistin concentration).

Experiments for analysis of fitness cost.

Growth curves for KPB-1 and KPB-2 were evaluated in triplicate, either with strains growing separately or with strains growing together in a competition experiment, as described previously (20). Growth was carried out in cation-adjusted MH broth (bioMérieux) at 37°C aerobically (50 ml of culture medium in 250-ml flasks, in an orbital shaker operating at 180 rpm) for 24 h. The viable cell counts were determined at various time points by plating, in triplicate, serial dilutions of the cultures onto either MH agar or MH agar supplemented with colistin (3 μg/ml). The competition index (CI), defined as the colistin-resistant strain CFU/colistin-susceptible strain CFU ratio, normalized against the total amount of CFU inoculated for each strain, was calculated as described previously (21).

Restoration of colistin susceptibility in the PmrB^L82R mutant with wild-type pmrB complementation.

Expression of wild-type PmrB in the KPB-2 background was able to restore colistin susceptibility, with an MIC value comparable to that of KPB-1 (Table 2). In KPB-2 (pACYC-pmrB), the expression levels of pmrA and pmrK were also reduced to basal levels (Table 2). Expression of the PmrB^L82R mutant in the KPB-1 background, on the other hand, did not result in an increased colistin MIC or in upregulation of expression of the pmrA and pmrK genes (Table 2). Finally, expression of the PmrB^L82R mutant in the KPB-2 background resulted in further increases in the colistin MIC and expression of the pmrA and pmrK genes (Table 2). Together, these findings confirmed the role of the PmrB^L82R mutation in colistin resistance through upregulation of the PmrA/PmrB signaling system and of the PmrHFIJKLM LPS modification system, and they also indicated that wild-type PmrB is dominant versus PmrB^L82R in regulation of the LPS modification system and in autoregulation of the PmrA/PmrB signaling system.

The mechanisms by which the L82R amino acid substitution in PmrB activates the PmrA/PmrB signaling system in the absence of the physiological activating signals (e.g., Fe³⁺, Al³⁺, and mildly acidic pH) and by which this activation is suppressed in the presence of the wild-type PmrB protein remain to be clarified and will require additional investigation. The most likely hypothesis is that the L82R amino acid substitution, which is located within the transmembrane domain of the protein (29), might result in some activation (autophosphorylation) of PmrB^L82R in the absence of the physiological activating signals, which might be suppressed by the phosphatase activity of wild-type PmrB when the latter protein is coexpressed with PmrB^L82R in the absence of activating signals.

Stability and fitness cost of the PmrB^L82R mutation.

In order to evaluate the stability of the colistin-resistant phenotype mediated by the PmrB alteration, KPB-2 was cultured for approximately 50 generations in the absence of antibiotic, and the resulting bacterial population was tested for colistin resistance. The results of this experiment showed that 100% of the tested cells were still resistant to colistin, suggesting that the colistin-resistant phenotype conferred by this mutation was very stable, even in the absence of selective pressure.

In order to evaluate whether the colistin-resistant phenotype mediated by the PmrB alteration was associated with a fitness burden, growth curves for KPB-1 and KPB-2 were compared, either with the strains growing separately or with the strains growing together in a competition experiment. No significant differences were observed between the growth curves for KPB-1 and KPB-2, grown either separately (data not shown) or together (Fig. 2). In the competition experiment, the CI values remained stable overall (Fig. 2). Together, these results suggested that the colistin-resistant phenotype mediated by the PmrB^L82R alteration was not associated with a significant fitness cost. Interestingly, these results are different from those observed previously with colistin-resistant pmrB or pmrA mutants of A. baumannii, which consistently exhibited reductions in fitness in comparison with the colistin-susceptible progenitors (20, 21, 25, 30).

Open in a separate window

FIG 2

Growth curves for the KPB-1 (colistin-susceptible) and KPB-2 (colistin-resistant) K. pneumoniae isolates obtained in the competition experiment. The competition index (CI) values were determined at various time points, as previously reported (21).

It should be noted that, in the KPB-2 colistin-resistant mutant investigated in this work, a missense mutation was also detected in the wzc gene, which was assumed to be not involved in colistin resistance and was not investigated further in this work. Whether the wzc mutation might play a role in compensating for any potential fitness defect associated with expression of the PmrB^L82R mutant in this context remains to be clarified and will be the subject of future investigation.

The valuable scientific advice of Cesira Galeotti is gratefully acknowledged.

This work was supported by a grant from FP7 projects from EvoTAR (grant HEALTH-F3-2011-2011-282004) to G.M.R.