Autophagy is essential for β-glucan and BCG training in monocytes

Using an in vitro model of trained immunity [6], [7], adherent monocytes from healthy human volunteers were stimulated for 24 h with RPMI, BCG or β-glucan alone or in combination with the autophagy inhibitors 3-methyladenine (3MA) or wortmannin. After washing of cells and a resting period of 6 days in medium supplemented with 10% human serum, cytokine production was measured after a second stimulation with the unrelated stimuli LPS or Borrelia burgdorferi (B. burgdorferi) (Figure 1b). IL-6 and TNF-α production increased significantly in BCG- and β-glucan-trained cells compared to non-trained cells. When autophagy was blocked by 3MA or wortmannin, neither β–glucan nor BCG induced trained immunity (Figure 1c–f; Figure S1a–h). Notably, the putative cytotoxic effects of autophagy inhibitors used in this study were assessed by LDH measurements. None of the inhibitors used during the 24 h of primary cell stimulation enhanced LDH release compared to RPMI-treated cells (Figure S2 a–c), demonstrating that the molecules were not toxic to the cells.

Single nucleotide polymorphisms in ATG2B and ATG5 negatively influence trained immunity

To further explore the role of autophagy in the nonspecific protection of BCG in innate immune cells, we examined the effects of genetic polymorphisms in autophagy genes for the BCG-induced trained immunity in vitro and in vivo. The genotypes of nine SNPs in eight autophagy genes were correlated with the capacity of BCG to induce trained immunity in a group of 72 volunteers. The rs3759601 ATG2B SNP was found to be strongly associated with trained immunity; the ability to develop training characteristics following BCG treatment was observed in monocytes isolated from individuals carrying the GG (major) or CG genotype but not in those carrying the CC (minor) genotype (plus strand coding) (Figure 2a–f). A similar effect, though less clear, was apparent for the rs2245214 ATG5 SNP (Figure 2g–i). No significant association was found between the nonspecific protection of BCG and polymorphisms in ATG10, ATG16L1, EREG, IRGM, LAMP3 and WIPI (Figure S3).

Open in a separate window

Figure 2

Polymorphisms in ATG2B or ATG5 diminish the training capacity of human monocytes.

(a–i) Blood was collected from volunteers and genotyped for ATG2B rs3759601 (a–f) and ATG5 rs2245214 (g–i). Human monocytes were trained with BCG for 24 h, washed and incubated in RPMI (10% human serum) for 6 d, after which they were restimulated for 24 h with a second stimulus (LPS, Bb, or C. albicans). Proinflammatory cytokine production (IL-6 and TNF-α) was assessed by ELISA in the supernatants. (j–k) PBMCs isolated from volunteers carrying different genotypes for SNPs rs3759601 or rs2245214 were stimulated for 24 h with LPS or B. burgdorferi. IL-6 was measured in the supernatants by ELISA. (l) Human monocytes carrying different genotypes for SNP rs3759601 were trained with BCG for 4 h. Expression of ATG2B was assessed by qPCR *P<0.05, **P<0.01.

To test the possibility that the association between SNPs and differences in cytokine production of BCG-trained monocytes was due to differential intrinsic capacity of the cells to produce cytokines, we stimulated monocytes bearing different ATG2B (Figure 2j) or ATG5 (Figure 2k) alleles with LPS or B. burgdorferi for 24 hours. We noted no differences in cytokine release, indicating that the capacity of cells to release proinflammatory cytokines upon stimulation was not responsible for the observed association between autophagy SNPs and BCG-induced trained immunity. Next to that, the effect of the rs3759601 SNP on the transcription of the ATG2B gene was assessed after training. We observed increased levels of ATG2B transcripts in BCG-trained cells of individuals carrying the GG genotype but not in those carrying the CC genotype (Figure 2l). Increased ATG2B levels could also be found in β-glucan trained individuals carrying the GG genotype (Figure S4a) but no difference in ATG2B levels could be found in the two groups after LPS stimulation (Figure S4b). The reduced expression of ATG2B in individuals carrying the CC genotype of the SNP upon training with BCG could indicate a role for autophagy in trained immunity since it has been shown that the ATG2 proteins are essential for the formation of autophagosomes [11].

Autophagy is influenced by ATG2B single nucleotide polymorphism

To identify the effect of rs3759601 in ATG2B on autophagy, the amount of LC3⁺ vesicles in BCG stimulated monocytes of individuals carrying the major or minor variant of the SNP have been compared. A decrease in autophagosome formation of individuals carrying the CC genotype can be seen as demonstrated by a lower percentage of LC3⁺ monocytes (Figure 3a–b).

Open in a separate window

Figure 3

Autophagy affected by SNP in ATG2B.

(a–b) Monocytes genotyped for ATG2B rs3759601 were seeded on coverslips, and stimulated with BCG. After 1 hour of stimulation, cells were fixed and stained with an antibody against LC3. Slides were analyzed by confocal microscopy. Data are representative for 3 experiments.

ATG2B single nucleotide polymorphism influences in vivo training of monocytes

To corroborate the above data, we investigated BCG-induced training of monocytes in vivo by testing individuals carrying different ATG2B alleles. Monocytes were isolated from 16 healthy volunteers, before and 3 months after vaccination with BCG. Following stimulation with LPS (Figure S5a–b) or B. burgdorferi (Figure 4a–b), IL-1β and TNF-α production was significantly higher 3 months after vaccination in individuals who were bearing at least one G allele of the ATG2B SNP (n=12), while monocytes isolated from individuals carrying the CC genotype (n=4) showed no change in cytokine production after BCG vaccination.

Open in a separate window

Figure 4

SNP in ATG2B affects the efficacy of in vivo BCG-induced trained immunity.

(a–b) Monocytes isolated before and 3 months after vaccination of 16 naïve (nonexposed) volunteers were stimulated in vitro with B. burgdorferi. Proinflammatory cytokine production (IL-1β [a], TNF-α [b]) was assessed by ELISA in the supernatants. (c–d) Kaplan-Meier curves for recurrence-free (c) and progression-free (d) survival according to rs3759601 SNP genotype of 192 patients suffering from non-muscle invasive bladder cancer treated with ≥6 intravesical instillations of BCG. Each drop in a probability curve indicates one or more events in that group. Vertical lines indicate censored patients, i.e. those who reached the end of their follow-up without experiencing the event. Total number of patients and number of events (between brackets) per genotype category are indicated next to the corresponding curve. Numbers of patients at risk at selected time points for each genotype category are given below the plots. (e–g) Monocytes of bladder cancer patients isolated before and after 6 intravesical BCG instillations as initial treatment were stimulated in vitro with LPS. Proinflammatory cytokine production (IL-1β [e], IL-6 [f], TNF-α [g]) was assessed by ELISA in the supernatants *P<0.05, **P<0.01.

SNP in ATG2B correlates with the progression and recurrence of bladder cancer after BCG intravesical instillation therapy

In addition to the protective effects of BCG against secondary infections, non-specific therapy with intravesical BCG is also used as a therapeutic strategy for patients with non-muscle invasive bladder cancer (NMIBC; stages: Ta, T1, CIS) [12]. In a cohort of 192 NMIBC patients treated with at least 6 intravesical instillations of BCG we evaluated the association between the ATG2B SNP and prognosis in terms of recurrence and progression during the first five years after the primary NMIBC diagnosis. Analyses learned that those patients that carry one or two C alleles for ATG2B rs3759601 showed increased risk of recurrence (CG vs. GG: hazard ratio (HR)=1.73 (95% confidence interval (CI): 0.99–3.03) and CC vs. GG: HR=1.68 (95% CI: 0.78–3.27)) (Figure 4c) and progression (CG vs. GG: HR=1.57 (95% CI: 0.79–3.12) and CC vs. GG: HR=2.15 (95% CI: 1.00–4.66)) (Figure 4d). This finding of a correlation between the polymorphism in ATG2B to progression and recurrence of bladder cancer supports the hypothesis of a clinical relevance of the autophagy gene for the non-specific protective effects exerted by BCG. In addition, the responsiveness of circulating monocytes of bladder cancer patients has been investigated before and after BCG-therapy. Of high interest, individuals who received intravesical BCG therapy showed an increased cytokine response of their monocytes after stimulation with LPS in vitro (Figure 4e–g).

Healthy volunteers

In vitro cytokine stimulation experiments were performed with PBMCs isolated from buffy coats obtained from healthy volunteers (Sanquin Bloodbank, Nijmegen, the Netherlands). To analyze the effect of gene polymorphisms on trained immunity, blood was drawn from a group of healthy volunteers (age 23–73). For the in vivo BCG model, subjects (aged 20–36) who were scheduled to receive a BCG vaccination at the public health service, due to travel or work in tuberculosis-endemic countries, were asked to participate in this trial. Blood was drawn before and 3 months after the BCG vaccination. Informed consent was obtained from all human subjects.

The bladder cancer patients included in this study were selected from a total of 1,602 patients with primary urinary bladder cancer (UBC) from the Nijmegen Bladder Cancer Study (NBCS). The NBCS served as the Dutch discovery population in the UBC genome-wide association study led by Radboud University Medical Centre (RUMC, Nijmegen, the Netherlands) and deCODE Genetics (Reykjavik, Iceland). The NBCS has been described in detail before [27]. Cases with a previous or simultaneous diagnosis of upper urinary tract cancer, based on information from the Netherlands Cancer Registry, were excluded. Detailed clinical data concerning diagnosis, stage, treatment, and disease course (tumor recurrence and progression) were collected retrospectively based on a medical file survey. In the analysis we included a total of 192 cases with non-muscle invasive bladder cancer (NMIBC; stage Ta/T1/CIS) that received at least 6 intravesical BCG instillations as initial treatment (median follow-up time from initial transurethral resection of bladder tumor until last urological check-up visit was 5.2 years (range: 0.4–20)). All patients were from Caucasian background.

Microorganisms

C. albicans ATCC MYA-3573 (UC 820) yeast was heat-inactivated for 30 min at 95°C. B. burgdorferi, ATCC strain 35210, was cultured at 33°C in Barbour-Stoenner-Kelley (BSK)-H medium (Sigma-Aldrich) supplemented with 6% rabbit serum. Spirochetes were grown to late-logarithmic phase and examined for motility by dark-field microscopy. Bacteria were harvested by centrifugation of the culture at 7000× g for 15 min and washed twice with sterile PBS (pH 7.4).

Stimulation experiments

The mononuclear cell fraction was obtained by density centrifugation of blood diluted 11 in pyrogen-free saline over Ficoll-Paque (Pharmacia Biotech, Pittsburgh, Pennsylvania, USA). Cells were washed twice in saline and resuspended in culture medium (RPMI; Invitrogen, Carlsbad, California, USA) supplemented with 50 mg/L gentamicin, 2 mM L-glutamine and 1 mM pyruvate. PBMCs were counted in a Coulter counter (Coulter Electronics, Brea, California, USA) and their number was adjusted to 5×10⁶ cells/ml. A total of 5×10⁵ cells in a 100 µl volume was added to round-bottom 96-well plates (Greiner) with RPMI, E. coli LPS (10 ng/ml) or B. burgdorferi (1×10⁶/ml). After 24 h, the supernatants were collected and stored at −20°C until being assayed.

For training experiments, PBMCs (5×10⁵ for cytokine analysis; 10×10⁶ for ChIP analysis) were incubated for 1 h at 37°C in 5% CO₂. Adherent monocytes were selected by washing out nonadherent cells with warm PBS. Thereafter, cells were preincubated with RPMI, BCG vaccine (1 µg/ml BCG vaccine SSI from the Netherlands Vaccine Institute) or β-1,3-(D)-glucan (β-glucan) (10 ng/ml; kindly provided by Professor David Williams) for 24 h (4 h for Real-time PCR). After a resting period of 6 d in RPMI including 10% serum, cells were stimulated with E. coli LPS (10 ng/ml), C. albicans (1×10⁶/ml), B. burgdorferi (1×10⁶/ml), or RPMI for an additional 24 h. Supernatants were stored at −20°C until ELISA was performed. In the “inhibition” experiments, before training with BCG or β-glucan, the adherent monocytes were preincubated for 1 h with 10 mM 3-methyl adenine (3MA, Sigma).

Cytokine measurements

Concentrations of human IL-1β, IL-6 and TNF-α were determined in duplicates using commercial ELISA kits (Sanquin, Amsterdam, or R&D Systems, Minneapolis), in accordance with the manufacturers' instructions.

Real-time PCR

RNA from stimulated monocytes was isolated using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. Isolated RNA was reverse-transcribed into complementary DNA using iScript cDNA synthesis kit (Bio-Rad). Quantitative real-time PCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems) using a 7300 Real-time PCR system (Applied Biosystems). In each PCR a melting curve analysis was included to control for a specific PCR amplification. Primers used for the experiments (final concentration 10 µM) are shown below. Real-time quantitative PCR data were corrected for expression of the housekeeping gene B2M. Human ATG2B forward: ACCAGAGATAGCACCTTCTGAC and reverse: CCAATTAACCGTCCAATCTG; human B2M forward: ATGAGTATGCCTGCCGTGTG and reverse: CCAAATGCGGCATCTTCAAAC.

Isolation of genomic DNA and single nucleotide polymorphism analysis

In vitro training experiment: Using NCBI SNP database we selected SNPs in autophagy genes previously associated to diseases or with a minor allele frequency of at least 5% (ATG10 (rs1864183), ATG10 (rs3734114), ATG16L1 (rs2241880), ATG2B (rs3759601) [allele frequency: G=70%; C=30%], ATG5 (rs2245214), EREG (rs78803121), IRGM (rs4958847), LAMP3 (rs482912), WIPI (rs883541)). Blood samples were obtained by venapuncture. Genomic DNA was isolated from EDTA blood using standard methods, and 5 ng of DNA was used for genotyping. Multiplex assays were designed using Mass ARRAY Designer Software (Sequenom) and genotypes were determined using Sequenom MALDI-TOF MS according to manufacturer's instructions (Sequenom Inc., San Diego, CA, USA) as described previously [28].

In vivo BCG-cohort: DNA was isolated using the Gentra Pure Gene Blood kit (Qiagen), in accordance with the manufacturer's protocol for whole blood. DNA was dissolved in a final volume of 100 µl buffer. Genotyping of single nucleotide polymorphisms (SNPs) was performed using a pre-designed TaqMan H SNP genotyping assay (Applied Biosystems) according to the manufacturer's protocol.

NBCS: All bladder cancer patients were genotyped using the Illumina Infinium HumanCNV370-duo Bead-Chips. Imputation was performed (IMPUTE version 2.1 software) using the 1000 Genomes low-coverage pilot haplotypes (released June 2010, 120 chromosomes) and the HapMap3 haplotypes (released February 2009, 1920 chromosomes) as a combined reference panel [27]. SNP rs3759601 was imputed with IMPUTE info_score 0.99. The SNP followed Hardy-Weinberg equilibrium.

Transcriptome analysis

Gene expression was performed as described previously [29] and assessed using Illumina Human HT-12 Expression BeadChip according to manufacturer's instructions. The Illumina LIMS platform, BeadStudio was employed to perform image analysis, bead-level processing, and quantile normalization of array data.

Chromatin immunoprecipitation

Adherent monocytes were cultured as described above (see Stimulation Experiments). ChIP was performed using antibodies against H3K4me3 (Diagenode). ChIPed DNA was processed further for qPCR analysis. The following primers were used in the reaction (5′-3′): TNF-α forward: CAGGCAGGTTCTCTTCCTCT, TNF-α reverse: GCTTTCAGTGCTCATGGTGT; IL-6 forward: TCGTGCATGACTTCAGCTTT, IL-6 reverse: GCGCTAAGAAGCAGAACCAC; myoglobin forward: AGCATGGTGCCACTGTGCT, myoglobin reverse: GGCTTAATCTCTGCCTCATGAT.

Immunofluorescence staining

For immunofluorescence imaging, monocytes were seeded on coverslips pretreated with polylysine, fixed with 4% PFA for 15 min at room temperature followed by 10 min of fixation with ice-cold methanol at −20°C. After two washing steps with PBS, cells were permeabilized by 0.1% saponin (Sigma-Aldrich), blocked for 30 min in PBS plus 2% BSA, incubated for 1 h with a mouse mAb to LC3 (150; Nanotools), washed twice in PBS plus 2% BSA and stained by a secondary Alexa Fluor 555 goat anti-mouse Ab (1500; Molecular Probes), followed by DNA staining with 10 µM TO-PRO-3 iodide (642/661; Invitrogen). After the washing steps, slides were mounted in Prolong Gold antifade media (Molecular Probes). Images were acquired using a laser-scanning spectral confocal microscope (TCS SP2; Leica Microsystems) and LCS Lite software (Leica microsystems). 2 fields/donor including at least 40 cells each were counted and compared for the amount of LC3.

We thank Mathieu Platteel for the DNA isolation for the gene expression experiments.