Indels generated by CRISPR/cas9 on miRNAs processing sites impede their biogenesis

As mentioned above, CRISPR/cas9 system can edit genome DNA sequences resulting in indels, which can be recognized by T7EN1 assay in an efficient manner¹⁶. After transfected CRISPR/cas9 vectors with individual sgRNA sequences targeting miR-17, miR-200c, and miR-141 to HCT116 cells, we detected the cleavages at target loci of these miRNAs by T7EN1 assay. As shown in Fig. 2a, the multiple site-specific bands were detected, which demonstrated the existence of indels. These results were further confirmed by DNA sequencing in which the random sizes of indels adjacent to PAM sequence were identified (Fig. 2b).

Open in a separate window

Figure 2

Detection and confirmation of indels generated by CRISPR/cas9 editing.

(a) DNA cleavage by CRISPR/cas9 is detected by T7EN1 assay. (b) DNA sequencing confirms the deletions (Red) and insertions (Blue) generated by CRISPR/cas9 in selected miRNA genes. PAM sequences are highlighted by green. All the gels were run under the same experimental conditions and presented by using cropped images. Please refer to the supplementary for the full-length gel images.

Pri-miRNA is the direct transcript of miRNA gene and then processed by Drosha and Dicer to form short mature miRNA. Studies demonstrated that both flanking and internal structure of pri-miRNA can decide the efficiency of Drosha processing and, in turn, the biogenesis of miRNA¹⁷. As shown above, our results have shown that CRISPR/cas9 cleaves miRNA Drosha and Dicer processing sites leading to random sizes of indels on genomic DNA sequences. Then, we examined the primary miRNA expression. MiR-17 is one of six members in miR-17-92 cluster, and their primary miRNA is the gene transcript containing all 6 miRNA sequences. Likewise, miR-200c and miR-141 also share a same primary miRNA transcribed from miR-200c/141 cluster. As shown in Fig. 3a, pri-miR-17-92 and pri-miR-200c/141 clusters were upregulated, which imply that cleavage of miRNA Drosha and/or Dicer processing sites by CRISPR/cas9 could interrupt biogenesis of mature miRNA resulting in accumulation of pri-miRNAs. In order to further determine the effects of these indels on mature miRNA biogenesis, we cloned the wild-type miR-17 sequences as well as mutated miR-17 sequences with selected indels into pWPXL vectors, and then transfected them into HCT116 cells for exogenous expression of miR-17 in different single clones. As shown in Fig. 3b​bc,c, mature miR-17 was significantly elevated in the cells transfected with wild-type miR-17 sequences, but not in the cells transfected with the single clones containing mutated miR-17 sequences. Moreover, not only single clones with large pieces of deletion (6–18bp) can lead to the failure of mature miR-17 biogenesis, but also the clone with only 2 deletions and 1 insertion can impede the exogenous expression of miR-17 as well. These data strongly support that mutations generated by CRISPR/cas9 on the stem-loop structure of primary miRNA can result in the downregulation of mature miRNA by interrupting the process of biogenesis.

Open in a separate window

Figure 3

CRISPR/cas9 can impede the biogenesis process of miRNA.

(a) CRISPR/cas9 induces the accumulation of primary miR-17-92 and miR-200c/141 clusters (n=3). (b) Exogenous expression of miR-17 in HCT116 cells after transfected with wild-type miR-17 sequences and mutated sequences, respectively (n=3). (c) DNA sequencing confirms the deletions (Red) and insertions (Blue) in the single clones with mutated miR-17 sequences. *P<0.05. RQ: relative quantification.

Off-target effect of CRISPR/cas9 on miRNA editing

Off-target effect is the hallmark of all gene silence methodologies, including CRISPR/cas9 system. By using CRISPR DESIGN (http://crispr.mit.edu/), we predicted the off-targets of sgRNA-miR-17-1 and sgRNA-miR-200c-1 (Table 1), and examined their off-target effects accordingly. As shown in Fig. 4a, if the target sgRNA has more than 3 mismatches to the non-specific DNA sequences, there are no cleavages that can be detected by T7EN1 assay; however, if the mismatches are equal to or less than two, CRISPR/cas9 system can unbiasedly cleave the off-target sequences. The T7EN1 results were also confirmed by DNA sequencing (Fig. 4b). These results not only support the high specificity of CRISPR/cas9 system, but also provide a reference to guide the design of sgRNA sequences to reduce the off-target effects.

Open in a separate window

Figure 4

Determine the specificity of CRISPR/cas9 in editing miRNA.

(a) CRISPR/cas9 cannot cleave the off-target sequences with>=3 mismatches with sgRNA-miR-17-1 and sgRNA-miR-200c-1 by T7EN1 assay. “On” means on-target sequences; while “off” means off-target sequences. (b) DNA sequencing confirms the deletions (Red) and insertions (Blue) generated by CRISPR/cas9 in the off-target sequences containing<=2 mismatches with sgRNA-miR-17-1 and sgRNA-miR-200c-1. (c) Crossing off-target effects between sgRNA-200c and sgRNA-141 as determined by qRT-PCR (n=3). (d) T7EN1 assay confirms the DNA integrity of miR-200c subjected to sgRNA-miR-141 and that of miR-141 subjected to sgRNA-miR-200c. (e) Co-transfection of sgRNA-ZEB1 with sgRNA-miR-200c or sgRNA-miR-141 can significantly reduce crossing off-target effects on miR-141 or miR-200c, respectively (n=3). *P<0.05. RQ: relative quantification. All the gels were run under the same experimental conditions and presented by using cropped images. Please refer to the supplementary for the full-length gel images.

Table 1

Off-target sequences of sgRNA-miR-17-1 and sgRNA-miR-200c-1 predicted by CRISPR DESIGN (http://crispr.mit.edu/).

SgRNAs		Sequence	PAM	Score	Mismatches	UCSC gene	Locus	Products Size (bp)	Predicted Cleavage Size (bp)
miR-17-1_	On	TGTCAAAGTGCTTACAGTGC	AGG			NR_029487	chr13:92002869	348	165/183
	Off-1	TGTAAAAGTGCTTACAGTGC	AGG	100	1	NR_029523	chrX:-133304272	316	110/206
	Off-2	TGTCTAAGCTCTTACAGTGC	TAG	1.4	3		chr3:+151344524	357	106/251
	Off-3	GCTCAAAGTGCTGACAGTGC	TGG	1.2	3	NR_027774	chr17:+43514416	340	99/241
	Off-4	TCTCAAAGAGATTACAGTGC	TAG	0.9	3		chr1:-183330797	275	88/187
	Off-5	TGTCATAGCTCTTACAGTGC	TAG	0.8	3		chr9:+75156083	296	107/189
miR-200c-1_	On	ATACTGCCGGGTAATGATGG	AGG			NR_029779	chr12:7072907	259	118/141
	Off-1	ATACTGCCTGGTAATGATGA	CGG	2.4	2	NR_029639	chr1:+1102540	270	133/137
	Off-2	AAAATGATGGGTAATGATGG	GAG	0.9	4		chr15:-45922506	156	52/104
	Off-3	ATAATTCCAGGTAATGATGG	AAG	0.9	3		chr9:-20452104	200	66/134
	Off-4	CTCCTGCTGGATAATGATGG	CAG	0.8	4		chr8:+24105533	167	78/89
	Off-5	CTACTGCAGCATAATGATGG	AAG	0.7	4		chr18:-64345817	321	144/177

Open in a separate window

Note: “On” means on-target sequences, and “off” means off-target sequences. Mismatches are underlined.

It was known that the traditional miRNA silence strategies, such as antisense inhibitors and sponge, are less robust when being used to inhibit the expression of miRNAs from the same family, given their highly conserved sequences with a few mismatches. For example, miR-200c and miR-141 are transcribed from the same genomic locus, and only have 4 mismatches in their mature sequences. Based on our results shown above, the CRISPR/cas9 targeting miR-200c should not influence the expression of miR-141 because the mismatches are more than 3. However, as shown in Fig. 4c, both sgRNAs-miR-200c generated cross expression inhibition on miR-141, vice versa. To address this unexpected result, we first examined DNA integrity of miR-200c and miR-141 genes in cells transfected with sgRNA-miR-141 and sgRNA-miR-200c by using T7EN1 assay, but only single bands were identified (Fig. 4d), which suggests that no cleavage was induced by CRISPR/cas9 and downregulation of miR-200c and miR-141 might not be caused by off-target effects. Given the regulatory loop between miR-200c/141 and ZEB1, we hypothesize that ZEB1 transcriptional regulation may be involved in these unexpected “off-target” phenotypes. It means when miR-200c is downregulated by CRISPR/cas9, ZEB1 will be inversely upregulated, which can in turn repress the expression of miR-141 at transcriptional level. Likewise, sgRNA-miR-141 can downregulate miR-200c via alternation of ZEB1 as well. To prove our hypothesis, we co-transfected CRISPR/cas9 constructs targeting ZEB1 and miR-200c or miR-141 into HCT116 cells, respectively. As shown in Fig. 4e, when ZEB1 was silent by CRSPR/cas9, the cross inhibitory phenotypes between miR-200c and miR-141 were nearly dismissed.

We also extend our observation to mature miR-200b that only has 2 different nucleotides from mature miR-200c. First, we blasted the sgRNA-miR-200c sequences to mature miR-200b sequence, and found that sgRNA-miR-200c-1 had 2 mismatches with miR-200b but sgRNA-miR-200c-2 did not align with miR-200b at all. Then, we performed the T7EN1 assay and found sgRNA-miR-200c-1 can edit the genomic DNA locus of miR-200b but not sgRNA-miR-200c-2 (Fig. 5a). These results suggest that the crossing off-target effects for the miRNAs at same family or with highly conserved sequences can be minimized by proper design of sgRNAs, which is very flexible and feasible because the design of sgRNAs can be anchored to dispersive PAMs that are easily identified in DNA sequences.

Open in a separate window

Figure 5

Crossing off-target effects of CRISPR/cas9 on miRNAs in the same family.

(a) MiR-200b and miR-200c have only 2 different nucleotides in their mature sequences, and T7EN1 assay shows sgRNA-miR-200c-1 (with 2 mismatches) can cleave miR-200b DNA sequences, but not sgRNA-miR-200c-2 (without mismatches). We randomly made point mutations (1–4bp) within the sequence of sgRNA-miR-200c-1, and examined their targeting effects on miR-200c (b) and potential off-target effects on miR-200b (c) by using T7EN1 assay. There are no cleavages if mutations (MU) are more than 3bp. The digits in the figure can be interpreted by an example: 3[1,9,20] means there are 3 mutations locating at the 1^st, 9^th, and 20^th locus of sgRNA-miR-200c-1. All the gels were run under the same experimental conditions and presented by using cropped images. Please refer to the supplementary for the full-length gel images.

In order to further support our assumption, we randomly made point mutations (1–4bp) within the sequence of sgRNA-miR-200c-1 (Table 2), and examined their targeting effects on miR-200c and potential off-target effect on miR-200b by T7EN1 assay (Fig. 5b​bc).c). The results suggest that, if the numbers of mismatches are more than two, the mutated forms of sgRNA-miR-200c-1 show neither targeting effects on miR-200c, nor off-target effects on miR-200b, which suggest that high specificity and low off-target effect of CRISPR/cas9 in knockdown of miRNA. The T7EN1 results were also confirmed by DNA sequencing (data not shown).

CRISPR/cas9 to miRNAs construction and transfection

Plasmid lenti-CRISPR was requested from Dr. Feng Zhang’s lab through Addgene (#49535) and the plasmids constructed with protospacer sequence targeting GFP were used as the control vectors²⁴. Protospacer sequences of CRISPR/cas9 against miR-17, miR-200c and miR-141 were designed by CRISPR DESIGN (http://crispr.mit.edu/)²⁴. All specific target sequences were amplified and cloned into lenti-CRISPR vectors and verified by DNA sequencing. After the transient transfection of CRISPR/cas9 into cells by using Lipofectamine reagent (Life Technologies), puromycin (4μg/mL) (Life Technologies) treatment for 24 hours was employed for selection and then cells were expanded in the regular culture medium. Primers sequences are listed in Supplementary.

RNA isolation

TRIzol reagent (Life Technologies) was employed to isolate total RNAs from the cells and xenograft tissues. In brief, cells or gridded tissues were lysed in the mixture with 1ml TRIzol reagent and 100μl 1-bromo-3-chloropropane (BCP) (Molecular Research Center) by vigorously vortexing. After 10min of centrifugation at 14,000rpm at 4°C, the upper aqueous phase was transferred to a new tube and an equal volume of isopropanol (Sigma-Aldrich) was added for precipitation. After washing with 75% ethanol for 15sec, the pellets were air dried and eluted in nuclease-free water accordingly.

SYBR-based qRT-PCR analysis

Specific stem-loop reverse transcription (RT) primers for mature miRNAs including miR-17, miR-200c and miR-141 were designed, respectively, and U6 was used as the endogenous control. As to primary miRNAs and GAPDH reverse transcription PCR, random hexamers supplied in the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) were used. RT was performed at 37°C for 2h by incubating the mixture including 2μg of total RNA, 2μM RT primer for miRNAs or 1× random hexamers for primary miRNAs and GAPDH, 1× reverse transcription buffer and 1× dNTP at final concentration and nuclease-free water in a volume of 20μl. For quantitative real-time PCR (qRT-PCR), 2× SYBR master mix (Roche) were utilized following the manufacture’s protocol. For mature miRNAs and primary miRNAs expressions analysis, the endogenous controls, U6 and GAPDH, were adapted, respectively. The relative expressions of target genes were estimated by 2-^ΔΔCT Method. The quantification of CRISPR/cas9 vectors in HCT116 and HT-29 cell lines was evaluated by SYBR-based qRT-PCR (n=3). The yield of CRISPR/cas9 vectors in HT-29 xenograft tissues was measured by using an absolute quantification standard curve based on a dilution course of the control CRISPR/cas9 vectors.

Western blotting

Anti-E-cadherin antibody was purchased from Cell Signaling Technology (24E10), anti-E2F1 (05–379) and anti-ZEB1 (ABE596) antibodies were bought from EMD Millipore. Anti-alpha-tubulin antibody (sc-8035) was got from Santa Cruz Biotechnologies. In brief, cell lyses were prepared by RIPA lysis buffer (Thermo Scientific) and the protein concentrations were determined by a BCA protein assay kit (Bio-Rad). Samples were carefully loaded to SDS–PAGE gel, separated and transferred to polyvinylidene fluoride membranes (PVDF) (Bio-Rad). The transblots were blocked by 5% non-fat milk then were incubated with primary antibodies at 4°C overnight. After rinsing 3 times for 10 minutes each time with Tris-buffered saline solution containing 0.1% Tween 20 (TBST), peroxidase-linked secondary antibodies were incubated for 30 min. Finally, the transblots were incubated with SuperSignal West FemtoChemiluminescent Substrate (Thermo Scientific) for detection of HRP in dark chamber and images were captured by ChemiDoc™ XRS (Bio-Rad). The references for antibody dilution are alpha-tubulin: 1:1000; E-cadherin: 1:1000; E2F1: 1:1000; ZEB1: 1:250.

T7EN1 analysis and DNA sequencing

The genomic DNA from the cells and xenograft tissues was extracted by using Wizard Genomic DNA Purification Kit (Promega). DNA fragments spanning target sites of CRISPR/cas9 were amplified by GoTaq DNA Polymerase (Promega) and PCR products were purified by GeneJET PCR Purification Kit (Thermo Scientific). T7EN1 assay is a known method to detect mismatched DNA²³. In brief, total 200ng of purified PCR products were denatured and reannealed in 1× NEBuffer 2 (NEB) in 20μl volume in a thermocycler with following steps (95°C, 5min; 95-85°C at −2°C/s; 85-25°C at −0.1°C/s; hold at 4°C)³⁵. Then 10U of T7EN1 enzymes (NEB, M0302L) were added to hybridized PCR products and reaction mix was incubated at 37°C for 15 minutes. Reactions were stopped by addition of 2μl 0.5M EDTA. The products digested by T7EN1 were separated by 8% polyacrylamide gel electrophoresis (PAGE), stained with ethidium bromide (EB) and images were captured by ChemiDoc™ XRS (Bio-Rad). The PCR products subjected to T7EN1 enzyme digestion were also ligated to pGEM-T Easy vectors (Promega) for DNA sequencing.

Plasmid construction and transfection

DNA fragments flanking pre-miR-17 were amplified by using DNA isolated from HCT116 cells transfected with sgRNAs targeting GFP and miR-17. The PCR products were qualitied by Agarose gel (Thermo Scientific) and purified by GeneJET PCR Purification Kit (Thermo Scientific), then ligated to pGEM-T Easy vectors (Promega) and sub-cloned into pWPXL vectors (Addgene, #12257). The sequences of the constructs were confirmed by DNA sequencing before transfection to the cells.

In vivo validation

The protocol for use of animals was approved the Institutional Animal Care and Use Committee (IACUC) of University of South Alabama, and all the procedures were carried out in accordance with the approved guidelines. To determine the stability of miRNA knockdown phenotype by CRISPR/cas9, HT-29 cells (1×10⁶ cells) transfected with CRISPR/cas9 targeting GFP and miR-17 were mixed with 50% matrigel in a volume of 100μl, respectively, and then injected into right flank of NCr-nu/nu mice (6–8 weeks old) subcutaneously. The xenograft tumors were dissected after 14 or 28 days incubation. Tissues were homogenized by using a small motor rotor and prepared for isolation of DNA and RNA.

This study was supported by an NIH/NCI R01 Grant (R01CA192395 to Yaguang Xi), American Cancer Society Research Scholar Grant (RSG-13-265-01-RMC to Yaguang Xi), and NIH/NCI R21 Grant (1R21CA182754 to Yaguang Xi).