Construction of Yeast Two-Hybrid cDNA Library of Bovine B Cells

Separation of B cell from bovine peripheral blood mononuclear cells (PBMCs) and construction of a yeast two-hybrid cDNA library have been previously described (Zhao et al., 2017). Briefly, 2 × 10⁷ B cells with purity of 95.3% were obtained and used for cDNA library construction and library titer was 2 × 10⁶ cfu with the size of inserted fragments varying from 750 to 3500 bp.

Bait Plasmid Expression in Yeast Cells

Total RNA of TaNM1 cells was extracted by using TRIzol Reagent and reverse transcribed into 1st strand cDNA. A 684 bp fragment of TaCyp1 gene encoding 228 amino acid residues (accession no.: XM_949388.1) (Figure ​(Figure1A)1A) was amplified from the cDNA and cloned into pGBKT7 plasmid between restriction sites EcoRI and BamHI using oligonucleotides: forward, CCGGAATTCATGCATCTTAGACAAAATATC, reverse, CGC GGATCCCAATAATTCTCCACAGTCCTC. Following the protocols of the Yeastmaker^TM Yeast Transformation System 2 kit (Clontech, United States) both pGBKT7-TaCyp1 and pGBKT7-53 (positive control) were transformed into the yeast strain Y2HGold. Total proteins were extracted from yeast cells and detected using mouse anti-Myc tag McAb (1/1000, Proteintech, United States) to detect TaCyp1 expression (Zhao et al., 2017).

Open in a separate window

FIGURE 1

Gene structure, expression, auto-activation, and toxicity tests for pGBKT7-TaCyp1. (A) Gene structure of TaCyp1, the whole length (aa1-228) of TaCyp1 was used in yeast-two-hybrid screening. (B) Western blot analysis of total proteins extracted from Y2HGold cells. TaCyp1 bait protein and positive control were 45 and 57 kDa in size, respectively. (C) Analysis of auto-activation and toxicity activity of pGBKT7-TaCyp1 bait plasmid in Y2HGold cells. The pGBKT7- TaCyp1 bait and pGBKT7 plasmids were transformed to Y2HGold cells and the transformants were grown on SD, SD/X, and SD/X/A agar plates, respectively; the co-transformants containing pGADT7-T and pGBKT7-53 were grown on DDO/X/A agar plates as positive control.

Auto-Activation and Toxicity Tests of Bait Plasmid

The protocol has been described previously (Zhao et al., 2017) and according to white colonies on SD/-Trp and SD/-Trp/X plates, and absence of colony growth on SD/-Trp/X/A plates, the bait plasmid was confirmed to lack auto-activation. Moreover, similar colonies size between bait and pGBKT7 plasmids indicated no toxicity indicating that expression of the bait plasmid had no auto-activation and toxicity and could be used in the yeast-two-hybrid screen.

Yeast-Two-Hybrid Screen and Sequences Analysis

To screen for host interacting proteins TaCyp1 bait and prey plasmids were co-transfected into Y2HGold, and screened as previously described (Zhao et al., 2017). The blue colonies on QDO/X/A agar plates were confirmed as positive hits. To reduce the number of false positives prey plasmids of the putatively positive colonies were rescued and co-transformed into Y2HGold with TaCyp1 bait plasmid, respectively. The co-transformant blue colonies were considered true positive hits.

Using primers of pGADT7-F/R the insert fragment of positive prey plasmids were amplified by PCR and sequenced and then blasted against NCBI databases to identify the corresponding bovine genes. The predicted protein function of the identified genes was analyzed using Gene Ontology¹, UniProt database², and STRING³.

Sub-Cellular Localization of TaCyp1 in TaNM1 Cells

The coding sequence of TaCyp1 was amplified from the cDNA of TaNM1 cells and cloned into BamHI and XhoI sites in pET30a using oligonucleotides: forward, CGC GGATCCATGTTAAAATTCTACAATCAACC, Reverse, CCG CTCGAGTCACAATAATTCTCCACAGTCC.

Subsequently, E. coli strain BL21DE3 (TransGen, Beijing, China) transformed with pET30a-TaCyp1 plasmid were cultured under the condition of 0.5 mM IPTG at 37°C for 8 h and then ultrasonic lysed after repeated freezing and thawing. The supernatant was collected by centrifugation and the recombinant His-TaCyp1 (rTaCyP1) protein was purified using Ni-NTA Purification System (Invitrogen, United States), which was used in sub-cellular localization and GST-pull down experiments. To obtain positive sera against rTaCyp1 New Zealand white rabbits were immunized with 200 μg of rTaCyp1 protein, emulsified in equal volumes of complete (day 0), or incomplete (days 14 and 28) Freund’s adjuvant (Sigma, United States) at 14-day intervals. Ten days after the last immunization sera were collected and purified using NAbTM Protein G Spin Kit (Thermo Fisher, United States). Sera before immunization were collected as negative control, and serum against TaSP used as positive control.

To investigate the localization of TaCyp1 TaNM1 cells were plated on coverslips for 24 h, and then fixed in PBS 4% paraformaldehyde for 20 min at room temperature. Coverslips were rinsed in PBS and permeabilized with PBS 0.5% Triton-X-100 for 5 min and then blocked with PBS 3% bovine serum albumin (BSA) at 37°C for 30 min to prevent non-specific staining. Subsequently, the coverslips were incubated with positive sera against TaCyp1 or TaSP (1/100) in PBS 1% BSA for 1 h at 37°C. After washing in PBS, the coverslips were stained with Hoechst 33342 (1/2000, Invitrogen, United States) and goat anti-rabbit IgG (H+L) secondary antibody Alexa Fluor 488 (1/1000, Invitrogen, United States) in PBS 1% BSA for 1 h at 37°C. Finally, coverslips were washed in PBS and stained with Alexa Fluor^TM 594 Phalloidin in PBS 1% BSA for 30 min at 37°C (1/100, Invitrogen, United States). All coverslips were washed in PBS and transferred to slides to observe using confocal microscopy (Leica, Germany).

GST-Pull Down

To further verify the interaction between TaCyp1 and prey proteins the coding sequences of prey proteins were amplified from cDNA of TaNM1 cells and cloned into pGEX-4T-1 plasmid. The recombinant pGEX-4T-1-prey plasmids were transformed and expressed in E. coli strain BL21 (TransGen, Beijing, China) and purified using glutathione-sepharose beads. Following protocols of Pierce^TM GST Protein Interaction Pull-Down Kit (Thermo Fisher Scientific, United States), beads coated with GST-tagged prey protein from 10 ml IPTG-induced E. coli culture were incubated with 100 μg His-TaCyp1 protein for 8 h at 4°C. Subsequently, beads were washed five times with washing buffer and eluted by 200 μL elution buffer. Anti-His tag (1/2000, Sigma, United States) or anti-GST tag mouse McAb (1/2000, Signal way Antibody, United States) were used as primary antibodies, by western blot detection. Meanwhile, GST and His tag proteins were expressed under the same conditions.

BW720c Treatment and siRNA Transfection

For drug-induced parasite death TaNM1 cells were treated with BW720C at 200 ng/mL for 72 h (Sigma, United States), and as a negative control were treated with an equal volume of DMSO. RNAi experiments were performed in six-well plates. 200 pm negative control or siRNA against target gene were transfected into TaNM1 cells using 10 μL lipofectamine 2000 reagent (Invitrogen, United States) and cells were collected in 36 h after siRNA transfection. All collected cells were used to extract total RNA or protein for RT-qPCR or western blot detection.

RT-qPCR

For all samples, total RNA was extracted using TRIzol reagent and the cDNA was synthesized using Prime-Script^TM RT reagent with gDNA Eraser kit (TaKaRa, Dalian, China). Quantitative PCR was performed using SYBR^TM Premix Ex Taq^TM II (Tli RNaseH Plus) (TaKaRa, Dalian, China) according to the following primers: TaCyp1, forward, TGGTTAAGGCAGT TGAAG, reverse, AATAATTCTCCACAGTCCTC; NF-κB1 (NM_001076409.1), forward, AAGAACAAGAAGTCCTACC, reverse, GACCAACTGAACAATAACC; NF-κB2 (NM_001102101.1), forward, GAGGATGATGAGAATGGAT, reverse, GAACACAATGGCATACTG; β-actin (Marsolier et al., 2015), forward, GGCATCCTGACCCTCAAGTA, reverse, CACACGGAGCTCGTTGTAGA. Relative gene expression comparisons were performed using ΔΔCT method and β-actin gene was used for stably expressed housekeeping gene.

TaCyp1 Bait Protein Has No Auto-Activation or Toxicity

The results of auto-activation showed the colonies containing pGBKT7 or pGBKT7- TaCyp1 plasmid were white on SD/-Trp/X plates, but blue on DDO/X/A plates for positive control, indicating that the TaCyp1 bait plasmid has no auto-activation activity (Figure ​(Figure1B).1B). Moreover, the size of the colonies containing bait plasmid was similar to that containing the pGBKT7 plasmid, indicating that the TaCyp1 bait plasmid has no toxicity in Y2HGold cells and that it could be used in the yeast-two-hybrid screen.

Two Host Proteins Interact With TaCyp1

Following screening on higher stringency QDO/X/A plates, six blue colonies were finally obtained, which were likely to be positive hits. After plasmid extraction prey plasmids were rescued by transforming E. coli DH5α cells. Subsequently, the inserts were amplified by PCR using primers of pGADT7-F/R and their size indicated by gel electrophoresis (Figure ​(Figure2A).2A). To eliminate false positive hits, each of these six prey plasmids was co-transformed with pGBKT7- TaCyp1 into Y2HGold cells and the co-transformants were grown on QDO/X/A plates. Only two co-transformants gave blue colonies growth (Figure ​(Figure2B).2B). As a control, co-transformants containing pGKBT7 and each prey plasmid gave no colonies on QDO/X/A plates (data not shown). So these two host proteins were considered to interact with TaCyp1.

Open in a separate window

FIGURE 2

Analysis of putatively positive colonies. (A) Analysis of PCR products of the inserts on putatively positive prey plasmids. M: DNA 5000 maker; Lane 1–6: PCR amplification products of the inserts on the six putatively positive hits. (B) Confirmation of putative hits. The pGBKT7-TaCyp1 bait plasmid was transformed with each of the six putatively positive prey plasmids (number 1 to 6) into Y2HGold cells. Meanwhile pGADT7-T and pGBKT7-Lam plasmids were co-transformed into Y2HGold cells for negative control, whereas pGADT7-T and pGBKT7-53 were co-transformed into Y2HGold cells for positive control. All co-transformants were grown on QDO/X/A plates, and positive interaction was indicated by the presence of blue colonies.

The two fragments displayed 99% similarity with Bos taurus mediator complex subunit 21 (MED21, accession no.: NM_001038566.1) and Bubalus bubalis SEC31 homolog A transcript variant X8 (SEC31A, accession no.: XM_006074437.1), respectively. The two fragments encoded full-length of MED21 and 523 residues from the C terminus of SEC31A, respectively. Interestingly, functional prediction suggested MED21 could be a mediator of RNA polymerase II transcription subunit 21 and component of a coactivator involved in regulating transcription of nearly all RNA polymerase II-dependent genes. In general, MED21 is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. SEC31A is a component of the coat protein complex II (COPII), which is involved in transporting secreted and membrane proteins out of the endoplasmic reticulum. Through direct interaction with Sar1 and SEC23, the SEC13-SEC31 complex polymerizes into a polyhedral cage structure to form the functional outer coat that drives vesicle formation (Stagg et al., 2006; Bi et al., 2007; Fath et al., 2007).

TaCyp1 Is Mainly Distributed Around T. annulata Schizonts

To reduce non-specific staining all sera were purified using NAbTM Protein G Spin Kit. As a positive control a serum against TaSP was used and gave green fluorescence associated with membrane of T. annulata schizonts, consistent with TaSP being a membrane protein (Seitzer et al., 2010). No green fluorescence was observed with samples stained with negative serum. For samples stained with serum against TaCyp1 green fluorescence was mainly observed around T. annulata schizonts (Figure ​(Figure3).3). DNA stained with Hoechst 33342 (blue) and cytoskeleton stained with Alexa Fluor^TM 594 Phalloidin (red) were observed in all samples. The images indicate that in TaNM1 cells TaCyp1 is mainly distributed around T. annulata schizonts, a localization providing an opportunity to interact with host proteins.

Open in a separate window

FIGURE 3

Sub-cellular localization of target proteins. NC stained with negative serum was no green fluorescence, and TaSP was observed with green fluorescence on membrane of T. annulata shizonts as positive control (yellow arrow). TaCyp1 was mainly distributed around membrane of T. annulata shizonts (white arrow). Cell cytoskeleton stained with Alexa Fluor^TM 594 Phalloidin and DNA stained with Hoechst 33342 were observed with red fluorescence and blue fluorescence, respectively, and target proteins stained with purified sera and Alexa Fluor 488 were observed with green fluorescence. The merge were fused images under the above three conditions.

MED21 Interacts in vitro Directly With TaCyp1

The predicted sequences of the prey proteins identified them to be MED21 and SEC31A and so both inserts were cloned into the BamHI and XhoI restriction sites of pGEX-4T-1 p. The oligonucleotides used were: MED21, forward, CGCGGATCCAGGAACATGGCGGATCGGCT, reverse, CCGCTCGAGTGAGTCTGGAAGAGACTGG; SEC31A, forward, CGCGGATCCAAACTAA TTGCATGTTGGAC, reverse, CCGCTCGAGGACACCCAGCTTGTTGGCCT. Subsequently, GST-MED21 or GST-SEC31A recombinant proteins were expressed in E. coli strain BL21 (TransGen, Beijing, China). GST pull-downs showed GST tag or GST-MED21 recombinant protein did not bind to His tag protein. Meanwhile, His-TaCyp1 protein also had no binding to GST tag protein in vitro, but in contrast GST-MED21 bound to His-TaCyp1 indicating a direct interaction between TaCyp1 and MED21 (Figure ​(Figure4).4). For the GST-SEC31A recombinant protein no binding was observed between GST-SEC31A and His-TaCyp1 proteins (data not shown). So we focused on the interaction of TaCyp1 with the host protein MED21.

Open in a separate window

FIGURE 4

Western blot analysis of GST-pull down experiments. Input were the mixed supernatants including GST-MED21+His tag protein, GST-MED21+His-Cyp1, GST tag protein+ His tag protein, GST tag protein+ His-Cyp1 from left to right, and identified by western blot using anti- His or GST tag antibody. The eluted protein complexes were identified by western blot with anti-His tag protein antibody.

Knock Down of MED21 Results in a Significant Decrease in NF-κB1/κB2 mRNA Expression

Quantitative PCR primers of MED21A was used to detect MED21 mRNA expression: forward, ATATTCAGACAGCCAT TA, reverse, GAATCTATCAGAACATCAAT. Meanwhile the NC and MED21 siRNA were used in RNAi experiment: NC, sense, UUCUCCGAACGUGUCACGUTT, antisense, ACGUGACACGUUCGGAGAATT; siMED21-1, sense, GGACGCUGUGAACUCGCUUTT, antisense, AAGCGAGUUCACAGCGUCCTT; siMED21-2, sense, CCUCCUGCCUCCUUUAGUATT, antisense, UACUAAAGGAGGCAGGAGGTT. To investigate the potential role of MED21 in Theileria-infected cells, we used siRNA to deplete MED21 by siRNA. After siMED21 RNAi, MED21 mRNA expression was significantly reduced (Figure ​(Figure5B).5B). Because MED21 is a component of the RNA polymerase II transcriptional subunit, we hypothesized that knock down of MED21 might lead to a reduction in NF-κB1/2 mRNA expression. This was indeed the case (Figures 5C,D). We also analyzed TaCyp1, MED21, and NF-κB1/2 mRNA levels following BW720c treatment. As expected, we found that TaCyp1 levels significantly decreased following killing of the parasite (Figure ​(Figure5A).5A). In contrast, there was no significant change in MED21 and NF-κB1/2 mRNA expression following treatment.

Open in a separate window

FIGURE 5

mRNA expression analysis of TaCyp1, MED21, NF-κB1, and NF-κB2. mRNA expressions of TaCyp1, MED21, NF-κB1, and NF-κB2 in TaNM1 cells were detected after BW720c treatment and MED21 RNAi experiments (A–D). In BW720c treatment experiment, mock group was added with PBS, NC group was added with DMSO; positive group was added with equal volume of BW720c; in MED21 RNAi experiment, mock group was with no RNA transfection, NC group was transfected with NC siRNA, positive group was transfected with siRNA. P < 0.01; P < 0.001. NS, not significant.