2.2. RNA extraction and PCR

Total RNA was extracted from GC tissues and cells by using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocols. U6 and β‐actin were used as endogenous controls to normalize miRNA and mRNA, respectively. The relative expression level was quantified using the $2^{-\mathrm{\Delta }\mathrm{\Delta }{C}_{\text{T}}}$ method. PCR for each sample was performed in triplicate. All primers (Realgene, Nanjing, China) used in our study were as follow: hsa‐miR‐664a‐3p: forward, 5′‐ACACTCCAGCTGGGTATTCATTTATCCCCAGCC‐3′; universal, 5′‐GCGAGCACA GAATTAATACGAC‐3′; U6 forward, 5′‐CTCGCTTCGGCAGCACA‐3′; reverse, 5′‐AACGCT TCACGAATTTGCGT‐3′; MOB1A forward, 5‐TTGTAAGTGGGTCTGAATAGC; reverse, 5‐GGTGAAAGGTAATGGCATCT; β‐actin forward, 5′‐GCATCGTCACCAACTGGGAC‐3′; reverse, 5′‐ACCTGGCCGTCAGGCAGCTC‐3′; Foxp3 forward, 5′‐TACTTCAAGTTCCAC AACATGCGACC‐3′; reverse, 5′‐CGCACAAAGCACTTGTGCAGACTCAG‐3′.

2.3. Colony formation assay

Each group of stable transfected GC cells was plated in six‐well plates (500 cells/well) and cultured in RMPI‐1640 medium for 3 weeks. The colonies were stained with crystal violet after washing away with PBS.

2.4. 5‐Ethynyl‐2′‐deoxyuridine (EdU) assay

Cell proliferation was measured using the EdU assay kit (RiboBio, Guangzhou, China). Firstly, cells were seeded into 96‐well plates (2 × 10⁴ cells/well) and cultured with complete medium for 24 hours before the addition of EdU (50 μmol/L). Then, cells were incubated for 2 hours at 37°C, fixed in 4% formaldehyde for 30 minutes and permeabilized with 0.5% TritonX‐100 for 10 minutes at room temperature. After washing with PBS, 1×ApolloR reaction cocktail (400 μL) was added to react with the EdU for 30 minutes. Next, Hoechest33342 (400 μL) was added for 30 minutes to visualize the nuclei. Finally, images of cells were captured under a microscope.

2.5. Invasion and migration assay

We used 24‐well BioCoat Matrigel Invasion Chambers (BD Biosciences, Franklin, New Jersey, USA) to evaluate migratory and invasive abilities of GC cells. 3 × 10⁴/well cells were suspended in 200 μL serum‐free medium and were seeded into the upper chamber containing an uncoated or matrigel‐coated membrane, and then complete medium (700 μL) was added into lower chamber. 0.1% crystal violet was used to stain the cells that invaded or migrated to the low membrane after 24‐hour incubation at 37°C in a humidified 5% CO₂ incubator. The experiments were performed in triplicates.

2.6. Immunohistochemistry

All samples were fixed in 4% formaldehyde solution and embedded in paraffin. Then, paraffin‐embedded sections were de‐waxed in xylene and were rehydrated in graded alcohols. The sections were then incubated with primary antibodies anti‐MOB1A followed by secondary antibody conjugated with HRP. Subsequently, detection was conducted by 3,3′‐diaminobenzidine and haematoxylin. We selected three randomly fields for examination.

2.7. Western blotting

The proteins were extracted from GC tissues and cells according to manufacturer's instruction. The concentration of proteins was determined by BCA. Then, the proteins were separated by 10% SDS‐PAGE and transferred onto PVDF membranes. Following, membranes were blocked with 5% non‐fat milk at room temperature for 2 hours, and incubated with specific primary antibodies overnight at 4°C, and then incubated with HRP‐conjugated secondary antibodies at room temperature for 2 hours. Finally, membranes were detected by Enhanced Chemiluminescence Detection Kit after washing with TBST buffer three times.

2.8. Dual luciferase reporter assay

The 3ʹ‐UTR sequences of MOB1A containing mutant (mut) or wild‐type (wt) miR‐664a‐3p binding sites were constructed by Genscript (Nanjing, China) and cloned into pGL‐3 luciferase reporter vector. Cells were co‐transfected with either the pGL3‐WT‐MOB1A or the pGL3‐MUT‐MOB1A 3′‐UTR reporter plasmids together with miR‐664a‐3p mimic or NC using Lipofectamine 3000 (Invitrogen) after incubation for 24 hours in 24‐well plate. In a next experiment, wild‐type or mutated Foxp3‐binding site reporter was constructed by GeneCopoeia (Nanjing, China) and was co‐transfected together with Foxp3 expression vector into HEK293 cells. Firefly and Renilla luciferase activity was assessed by the Dual‐Luciferase Assay System (Promega, Madison, WI, USA). The relative expression of firefly luciferase activity was normalized to Renilla luciferase activity. The experiment was performed in triplicate.

2.9. Chromatin immunoprecipitation assay

ChIP assay was performed using an EZ‐Magna ChIP kit (Millipore, Darmstadt, Germany) according to the manufacturer's instructions. Briefly, 2 × 10⁶ cells were cross‐linked with 1% formaldehyde for 15 minutes at room temperature and then quenched by adding 0.125 mol/L glycine. The cells were rinsed twice with PBS and collected after 5‐minute centrifugation at 800 g at 4°C. The samples were resuspended in 1% SDS lysis buffer, and the chromatin was sheared into 400‐bp fragment using an Ultrasonic Cell Disruptor (Covaris, Waltham, MA, USA). Foxp3 was immunoprecipitated from the supernatant using an anti‐Foxp3 antibody (normal rabbit IgG antibodies were used as negative controls) at 4°C with rotation for 16 hours. The complexes collected by magnetic beads were rinsed and eluted with 1% SDS and 0.1 mol/L NaHCO3, and DNA was purified on spin columns. Promoter binding was tested by PCR with SYBR Green Master Mix (Takara, Beijing, Japan). Enrichments were presented as percentage of the input.

2.10. Animal experiment

In this study, all the animal experiments were approved by Nanjing Medical University Ethics Committee. Four‐week‐old female nude mice (BALB/c nude mice) were purchased from the Department of Laboratory Animal Center of Nanjing Medical University. Stably transfected cells (2 × 10⁶ cells) resuspended in 100 μL PBS were injected into tail vein of mice, respectively. After 5 weeks, we observed the occurence of distance metastases using IVIS Imaging system (Caliper life Sciences, Hopkinton, MA, USA).

3.2. miR‐664a‐3p enhances invasion, migration and the EMT processing in GC cells

The wound‐healing assay and transwell assay were performed, and the results illustrated that the overexpression of miR‐664a‐3p in mimic group exerted active effect on GC cell invasion and migration (Figure ​(Figure2A,B),2A,B), while the downexpression of miR‐664a‐3p in inhibitor group showed opposite influence (Figure ​(Figure2C,D).2C,D). These data indicated that miR‐664a‐3p enhances cell invasion and migration of GC.

Open in a separate window

Figure 2

miR‐664a‐3p facilitates invasion, migration and EMT process in vitro. A,B, Wound‐healing assay was used to determine the migration of GC cells after transfection of miR‐664a‐3p mimic, NC and inhibitor lentivirous, respectively, in SGC7901 and HGC27. C,D, Effects of miR‐664a‐3p alteration on invasion and migration by transwell assay in vitro. E, Effects of miR‐664a‐3p on EMT process analyzed by Gene Set Enrichment Analysis (GSEA). F, The expression of EMT‐associated proteins detected by Western blot when expression of miR‐664a‐3p was altered in SGC7901 and HGC27. G,H, The Immunofluorescence assay of Ecadherin (red) and Vimentin (green) in SGC7901 and HGC27. The nucleus staining with DAPI (blue).*P < 0.05, **P < 0.01, ***P < 0.001. The data expressed as the mean ± SD

To clarify whether miR‐664a‐3p has impact on the EMT processing of GC cells, we first analysed that by Gene Set Enrichment Analysis (GSEA) and it showed that miR‐664a‐3p expression was positively correlated with EMT‐associated gene signatures (Figure ​(Figure2E).2E). Therefore, we evaluated the expression of EMT markers by using immunofluorescence analysis after transfection. The results revealed that the level of E‐cadherin (epithelial marker) was descended while Vimentin (mesenchymal marker) was rose in the mimic group, whereas it was contrast in the inhibitor group (Figure ​(Figure2G,H).2G,H). Moreover, Western blot analysis indicated that upregulation of miR‐664a‐3p expression increased the level of the epithelial marker (E‐cadherin) and attenuated the levels of the mesenchymal marker (N‐cadherin, Vimentin) and transcription factors (Slug, Snail). While downregulation of miR‐664a‐3p expression showed opposite (Figure ​(Figure2F).2F). These results demonstrated that miR‐664a‐3p might play a critical role on EMT progression thereby contributing to the invasion and migration of GC cells in vitro.

3.3. MOB1A is a direct target of miR‐664a‐3p and downregulated in GC tissues and cells

We utilized bioinformatics miRNA target prediction programs (Targetscan, starBase, PicTar and miRanda) to search for potential miR‐664a‐3p target genes. MOB1A was selected as a candidate since it has a latent miR‐664a‐3p‐binding site in its 3′‐UTR.

To assess the association between miR‐664a‐3p and MOB1A expression in GC tissues, we performed qRT‐PCR to analyse MOB1A expression in 58 pairs of GC tissue and matched adjacent non‐cancerous tissue samples. The outcomes proclaimed that the expression of MOB1A was downregulated in GC tissues (Figure ​(Figure3A).3A). We further confirmed the downexpression of MOB1A in six pairs GC tissues via Western blotting and immunohistochemistry, representative results were shown in Figure ​Figure3B,C.3B,C. Also, we concluded that MOB1A expression level was lower in GC cell lines than that in GES‐1 (Figure ​(Figure3D).3D). Furthermore, high expression of MOB1A contributed to better prognosis on the public database Kaplan‐Meier Plotter (http://kmplot.com/analysis/) (Figure ​(Figure3E).3E). Moreover, we obtained that expression of miR‐664a‐3p was negatively correlated with that of MOB1A (Figure ​(Figure3F).3F). We also evaluated the relevant between the MOB1A expression with patients’ clinicopathological characteristics (Table ​(Table11).

Open in a separate window

Figure 3

MOB1A is a direct target of miR‐664a‐3p and downregulated in GC tissues and cells. A, The relative expression of miR‐664a‐3p in 58 pairs of GC tissues. B, The expression of MOB1A was detected in six pairs of GC samples by Western blot. C, Representative IHC staining of MOB1A in six pairs of GC and normal specimens. D, The relative expression of MOB1A in GC cells compared to GES‐1. E, The survival analysis of MOB1A on the Kaplan‐Meier Plotter. F, Negative relation between of miR‐664a‐3p and MOB1A in GC tissues. G, Luciferase reporter assay was conducted to confirm that miR‐664a‐3p directly binded to the 3′‐UTR region of MOB1A. H, The relative expression of MOB1A after transfection of miR‐664a‐3p mimic, NC and inhibitor lentivirous by qRT‐PCR. I, Relative luciferase activity was analyzed in GC cells co‐transfcted miR‐664a‐3pmimics or NC with pGL3‐MOB1A‐WT or pGL3‐MOB1A‐MUT, respectively. J, Western blot was ultilized to determine the expression of MOB1A when miR‐664a‐3p expression was altered in GC cells

We further verified whether miR‐664a‐3p could directly target the 3′‐UTR of MOB1A mRNA by dual‐luciferase reporter assay. Wild‐type (WT) and mutant‐type (MUT) MOB1A 3′UTR sequences were subcloned into the pGL3 luciferase reporter vector. We noticed that the co‐transfection with miR‐664a‐3p mimic and pGL3‐MOB1A‐WT 3′UTR led to declined luciferase activity compared to that in control group (pGL3‐MOB1A‐MUT 3′UTR) (Figure ​(Figure3G,H).3G,H). We observed that increased expression of miR‐664a‐3p could obviously depress the mRNA and protein level of MOB1A, while knockdown expression of miR‐664a‐3p displayed reverse effect (Figure ​(Figure3I,J).3I,J). Taken together, our results suggested that MOB1A was a direct target of miR‐664a‐3p and was frequently downregulated in GC tissues and cells.

3.4. MOB1A reverses the effects of miR‐664a‐3p on GC cells

To further verify whether the effects of miR‐664a‐3p on invasion and migration in GC cells were mediated by ectopic expression of MOB1A, we overexpressed MOB1A by constructing lentiviral vector (Lv‐MOB1A) and inhibited by sh‐MOB1A. Our results showed that co‐transfection of Lv‐MOB1A in miR‐664a‐3p mimic cells reversed the promotional function of miR‐664a‐3p in EdU assay and colon formation assay (Figure ​(Figure4A,B).4A,B). Then, we knocked down the level of MOB1A in miR‐664a‐3p inhibitor cells, as expected, we concluded that decline of MOB1A eliminated the impact of miR‐664a‐3p inhibition on GC cells migration (Figure ​(Figure4A,B).4A,B). The numbers of colon formation were counted in Figure ​Figure4C4C and the rates of EdU‐positive cells in different groups were shown in Figure ​Figure4D.4D. We obtained similar results via wound‐healing assay and transwell assay (Figure ​(Figure4E‐H).4E‐H). The numbers of invasive and migratory cells were counted (Figure ​(Figure44I,J).

Open in a separate window

Figure 4

MOB1A restores the effects of miR‐664a‐3p on GC cells. A,B, Co‐transfection of Lv‐MOB1A in miR‐ 664a‐3p mimic cells reversed the promotional function of miR‐664a‐3p in EdU assay and colon formation assay in SGC7901 and HGC27. C,D, The number of colony formation and rate of EdU positive cells were counted in different groups. E,F, Wound‐healing assay was used to verify the rescuement effects of MOB1A on migration of GC cells. G,H, MOB1A eliminated the roles of miR‐664a‐3p on invasion and migration in SGC7901 and HGC27 using transwell assay. I,J, The cells counts of transwell assay in SGC7901 and HGC27. K,L, The expression of EMT‐associated proteins was detected when Lv‐MOB1A or sh‐MOB1A tranfected into miR‐664a‐3p mimic or inhibitor group in vitro. M,N, The immunofluorescence assay of E‐cadherin (red) and Vimentin (green) in SGC7901 and HGC27 after co‐transfection. The nucleus staining with DAPI (blue). *P < 0.05, **P < 0.01, ***P < 0.001. The data expressed as the mean ± SD

Subsequently, we applied immunoflurosence and Western blotting analysis to confirm whether miR‐664a‐3p accelerated the EMT progression of GC cells by targeting MOB1A. The fluorescence intensity of E‐cadherin was strengthened when stable transfected Lv‐MOB1A in miR‐664a‐3p mimic cells, while was weakened after transfection of sh‐MOB1A in miR‐664a‐3p inhibition cells. The fluorescence intensity of Vimentin showed opponent results (Figure ​(Figure4M,N).4M,N). Similarly, in Western blot assay, E‐cadherin expression was significantly increased when stable transfected Lv‐MOB1A in miR‐664a‐3p mimic cells, while decreased after transfection of sh‐MOB1A in miR‐664a‐3p inhibitior cells. Other related proteins (N‐cadherin, Vimentin, Snail, Slug) levels appeared opposite events (Figure ​(Figure4K,l).4K,l). The above results provided additional evidence that miR‐664a‐3p magnified GC process by targeting MOB1A directly in vitro.

3.5. miR‐664a‐3p contributes to tumour progression and metastasis in vivo

We performed xenograft assays to further validate the role of miR‐664a‐3p on tumour progression. SGC7901 and HGC27 cells transfected as described above were injected into the flanks of nude mice. As shown in Figure ​Figure5A‐C,5A‐C, the tumour volume and weight in miR‐664a‐3p mimic group were increased, while those were decreased in miR‐664a‐3p inhibitor group compared with those in miR‐NC group. Ki67 staining assay was used to further verify that miR‐664a‐3p promoted tumorigenicity. The Ki67‐positive ratio was higher in miR‐664a‐3p mimic group, while the opposite trend was shown in miR‐664a‐3p inhibitor group compared with that in miR‐NC group (Figure ​(Figure5D,E).5D,E). Furthermore, Western blot assay of tumour in mice indicated significant downregulation of MOB1A expression in miR‐664a‐3p mimic group, which was contrast in miR‐664a‐3p inhibitor group (Figure ​(Figure5F).5F). To validate the function of miR‐664a‐3p on tumour metastasis in vivo, stable transfected cells were injected into tail vein of BALB/c nude mice separately. After 6 weeks, we found a significant promotion on lung metastasis in miR‐664a‐3p mimic group compared to that in miR‐NC group. We also found a alleviation on lung metastasis in miR‐664a‐3p inhibitior group compared to that in miR‐NC group (Figure ​(Figure5G).5G). After that, mice were euthanized and then lung tissues were examined by H&E staining, which showed consistently results (Figure ​(Figure5H).5H). Collectively, these results demonstrated that miR‐664a‐3p could facilitate tumour progression and metastasis in vivo.

Open in a separate window

Figure 5

miR‐664a‐3p promotes metastasis of GC in vivo. A, photographs of tumors obtained from mice in miR 664a‐3p mimic and inhibitor groups. B,C, tumor volume and weight were calculated in miR‐664a‐3p mimic and inhibitor groups in SGC7901 and HGC27. D,E, Ki67 staining assay was used to further verify that miR‐664a‐3p promoted tumorigenicity. The Ki67 positive ratio was higher in miR‐664a‐3p mimic group, while the opposite trend was shown in miR‐664a‐3p inhibitor group compared with that in miR‐NC group. F, Western blot assay of tumor in mice indicated significant downregulation of MOB1A expression in miR‐664a‐3p mimic group, which was contrast in miR‐664a‐3p inhibitor group. *P < 0.05, **P < 0.01, ***P < 0.001. The data expressed as the mean ± SD. G, Representative photographs of tumors were taken by the IVIS Imaging System in different groups. H, Representative H&E‐stained sections of lung from mice in different groups.

3.6. Elevated expression of miR‐664a‐3p promotes GC progression by targeting MOB1A through inactivation of the hippo pathway

MOB1A is a important component of the Hippo pathway, which has been reported to be involved in tumour metastasis.28, 29 LATS1/2 are phosphorylated and activated by upstream molecules MST1/2, while MOB1A could associated with LATS1/2 to manifest its phosphorylation and potentiate its catalytic activity.30 Accumulating evidence demonstrated that activated LATS1/2 directly stimulate phosphorylation of the key transcriptional coactivators YAP and TAZ, which make YAP and TAZ trap within the cytoplasm.31 Dephosphorylation of YAP and TAZ duing to repression of phosphorylated LATS1/2 leads to the enrichment of YAP and TAZ in nucleus, which in turn causing negative impact on the downstream Hippo cascades.32

In our study, we verified that YAP and TAZ gathered more in nucleus due to the decline of MOB1A when miR‐664a‐3p was increased. In miR‐664a‐3p mimic cells, p‐LATS2, p‐YAP and p‐TAZ was reduced as a result of downexpression of MOB1A while we drawn a counter conclusion in miR‐664a‐3p inhibitor cells (Figure ​(Figure6A,B).6A,B). Subsequently, the expression of YAP and TAZ in nucleus was increased when miR‐664a‐3p was overexpressed both in SGC7901 and in HGC27 (Figure ​(Figure6C,D).6C,D). Immunofluorescence assay displayed analogous tendency (Figure ​(Figure6E,F).6E,F). Additionally, we confirmed that ectopic expression of MOB1A could restore the effect of miR‐664a‐3p. The expression of p‐LATS2, p‐YAP and p‐TAZ was restored after co‐transfection in SGC7901 and HGC27, respectively (Figure ​(Figure6A,B).6A,B). Simultaneously, the accumulation of YAP and TAZ in nucleus was altered (Figure ​(Figure6C,D),6C,D), and the fluorescence intensity of YAP and TAZ exhibited correspondingly result (Figure ​(Figure6E,F).6E,F). As expected, these findings were consistent with our postulation that elevated expression of miR‐664a‐3p promotes GC metastasis by targeting MOB1A through inactivation of the Hippo pathway.

Open in a separate window

Figure 6

miR‐664a‐3p plays a role in GC cells by directly targeting MOB1A through inactivation of the Hippo pathway. A,B, The alteration of downstream moleculars of the Hippo pathway detected by Western blot. C,D, Elevation of miR‐664a‐3p expression contributed to the trap of YAP and TAZ in nucleus. E,F, YAP and TAZ was accumulated in nucleus in SGC7901 and HGC27, respectively, by immunofluorescence analysis due to increase of miR‐664a‐3p expression and MOB1A could rescue the effects

This work was partially supported by the National Natural Science Foundation of China (81572362); the National Natural Science Foundation Project of International Cooperation (NSFC‐NIH, 81361120398); the Primary Research & Development Plan of Jiangsu Province (BE2016786); the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD, JX10231801); 333 Project of Jiangsu Province (BRA2015474); Jiangsu Key Medical Discipline (General Surgery).