Released males swarm participation

Stratified randomised sampling of the study area (see methods), resulted in 268 swarms (minimum 2 or more males) collected over 139 swarm markers over the 20-day MRR study. Of those swarms, 87 (32.1%) out of 268 consisted of a mixture of wild males and marked males and are referred to herein as ‘mixed swarms’, the other 182 swarms (67.5%) were formed by wild males only. Over the 20-day recapture period, mixed swarms were captured over 49 (35.8%) markers and wild type only swarms over 90 (64.7%) markers.

In the first 3 days of recaptures, GM and sibling dust-marked males combined dominated swarm samples (Fig. 4A). Swarms with mixed genotypes were more abundant than wild males until day 8 of the MRR study (Fig. 4B). Overall, mixed swarms sometimes consisted of Ac(DSM)2 and wild males, n=7 (8.0%), but most commonly all three genotypes were caught together n=43 (42.5%) or siblings were caught along with wild males n=50 (49.5%). In terms of swarm marker use, this translated into 5 (10.2%) markers used by Ac(DSM)2 and wild males and the 44 (89.8%) markers used by males of all three genotypes (Fig. 5). Mixed swarms of all types were found over swarm markers that attracted few males and markers that attracted intermediate or large numbers of males (Fig. 5). Despite the lower overall number of Ac(DSM)₂, there was no significant difference in the estimated size of mixed swarms that involved them or siblings with wild males from day 1 to 11 where all three genotypes were caught (Kruskall-Wallis: n=82, df=2, χ²=5.0, P=0.0678).

Open in a separate window

Fig. 4

A and B. Genotypic composition of male swarm recaptures and proportion of mixed versus wild male swarms.

A Total number of Ac(DSM)2 males, WT-Ac(DSM)2 sibling and wild males captured each day; B Proportion of mixed swarms and wild male swarms sampled each day. (Ac(DSM)2: Anopheles coluzzii Dominant Sterile Male; WT sibling: Wild type sibling; WT-Ac(DSM)2: Wild Type Anopheles coluzzii Dominant Sterile Male).

Open in a separate window

Fig. 5

The proportion of marked males of each genotype and wild unmarked males captured over markers where mixed swarms were found.

Each bar represents one swarm marker. Mixed swarm markers are sorted left to right by increasing total number of males captured over each marker over 20 days, which ranged from 1 (left) to 220 (right). Bar labels describe the total number of males of each genotype collected. (ACDSM2: Anopheles coluzzii Dominant Sterile Male; WT sibling ACDSM2: Wild type sibling Anopheles coluzzii Dominant Sterile Male; WT: Wild Type).

Temporal distribution of recaptures and Euclidian dispersal distance

Overall, the Euclidian dispersal distance of released Ac(DSM)2 mosquitoes derived from swarm and PSC recapture ranged from 50.8m to 497m, with mean 136.8m, and recaptures were limited to the Bana Centre zone. For their non-transgenic WT-Ac(DSM)2 siblings, the dispersal distance ranged from 50.8m to 1678m with mean 171.1m, and four males were recaptured as far as the neighbouring zone of Bana Market located around 1.5km from the release site. Thus, the transgenic Ac(DSM)2 mosquitoes had significantly lower mobility than their WT-Ac(DSM)2 siblings (Mann-Whitney: Z=4.592; df= 1; P<0.0001).

Bayesian estimates of survival, dispersal and population size

We fitted a passive diffusion model to the swarm and PSC recapture data to infer, in each case, a posterior distribution for the mobility of each type of released male, and the unmarked population size (see ‘Methods’). Posterior predictive checks revealed that the model had good explanatory power when fitted from the swarm data, with a coefficient of determination (R2) in the range 0.65 to 0.83 (95% CI) when comparing observed to simulated swarm data (see Supplementary Fig. ¹). By contrast, the model had poor explanatory power when fitted from, and compared against, the PSC data (R2 ranged from −0.28 to 0.48; see Supplementary Fig. ¹). This may indicate that the assumptions of the model are too inaccurate to capture the behaviour of the mosquitoes that were recaptured by PSC, or it may more simply reflect sampling noise associated with the small number of PSC recaptures. The high degree of determination of the swarm-based predictive checks, however, gives confidence that the model’s posterior distribution and percentiles provide an adequate description of the swarm data (see Supplementary Fig. ² and Table 3). Plots of posterior samples for each pair of parameters revealed a modest degree of positive covariance between mobility and survival for each type of released male, meaning that the upper-bound estimates of mobility were consistent with the upper-bound estimates of survival and vice-versa (see Supplementary Fig. ³). The remaining parameters did not co-vary in the posterior distribution (see Supplementary Fig. ³).

Table 3

Bayesian posterior percentiles of population size, survival and diffusion, inferred from the swarm recapture data.

Parameter	Posterior percentiles
	2.5%	50%	97.5%
Ag(DSM)2 daily survival	0.62	0.68	0.75
WT-Ac(DSM)2 (sibling) daily survival	0.81	0.84	0.87
Ag(DSM)2 Diffusion rate (m2day-1)	9600	11200	14400
WT-Ac(DSM)2 Diffusion rate (m2day-1)	7600	8700	10000
Population density (mosha-1)	375	430	487

Open in a separate window

Ag(DSM)2Anopheles gambiae Dominant Sterile Male, WT-Ac(DSM)2Wild Type Anopheles coluzzii Dominant Sterile Male.

The swarm-based posterior estimates indicate that Ac(DSM)2 males were less robust than their WT-Ac(DSM)2 siblings, with daily survival probabilities ranging from 0.61 to 0.75 and 0.81–0.87 respectively. By contrast, Ac(DSM)2 males appear to be somewhat more mobile than the sibling males, though there is overlap in the posterior distributions (p=0.02, where p is the fraction of pairwise posterior samples in which sibling mobility was greater than Ac(DSM)2 mobility). Population density within the MRR study area was estimated to be in the range 380–490 adult males ha⁻¹ (95% CI), which translates to 28,000–37,000 adult male mosquitoes in the study area of Bana Centre (the area shown in Supplementary Fig. ⁴).

From these results we estimated life expectancy (average lifespan) to be in the range of 2.6–3.9 days for Ac(DSM)2 males and 5.2–7.5 days for WT-Ac(DSM)2 siblings (using the equation $L=1/\left(1-s\right)$ where L is life-expectancy and s is daily survival). We estimated the expected lifetime displacement (the average distance from mosquito emergence to the location of its death) to be in the range 224–336m for Ac(DSM)2 males and 281–362m for their male siblings (using the equation $d=\sqrt{2DL}$, where $D$ is the diffusion rate). These distances are greater than the average Euclidian dispersal distances calculated directly from the recapture data, which is consistent with our expectation that recapture distances will underestimate lifetime displacement. This is because mosquitoes that are recaptured die prematurely (from their recapture).

Study design

The study design followed the format of an MRR experiment with an intensive period of recaptures followed by several months of monitoring to confirm the disappearance of the transgene. Both the period (July) and design (MRR-like experiment) were informed by previous baseline entomological studies and MRR experiments conducted in the same village^41,52. Given the low population size expected in July and to avoid over-sampling, a lower recapture effort (reduction of daily swarm sampling number) was implemented than in previous MRR studies performed in the same area.⁴¹ The month of July corresponds to the start of the rainy season, when regular rains and cooler weather promote mosquito survival, and the target population of A. coluzzii is at a much lower level than later in the rainy season^41,52. In July, plant coverage is still sparse and males tend to seek refuge inside houses and can be captured in good numbers via indoor sampling⁵².

GM sterile strain maintenance

The mosquito strain used in the experiment was the genetically modified mosquito Anopheles coluzzii sterile male strain referred to as Ac(DSM)2 (for Anopheles coluzzii Dominant Sterile male strain 2). This strain is the product of local introgression (series of backcrosses) of the original Ag(DSM)2 (dominant sterile male on Anopheles gambiae G3 mosquitoes strain 2) with a local A. coluzzii wild-type (WT) colony (female DSM-carrier crossed with male WT)³⁴. The importation of Ag(DSM)2 in Burkina Faso, introgression with local wild type background and maintenance were conducted under regulatory authorisation from the National Biosafety Agency (N°000002/MRSI/SG/ANB of October 21th 2016). The wild-type A. coluzzii strain used for introgression and maintenance of Ac(DSM)2 was colonised in July 2014 from gravid female adults collected in village 7 of the Kou valley (VK7) in western Burkina Faso. Both colonies were maintained in a dedicated ACL2 (Arthropod Containment Level 2) insectary located within the IRSS main campus at Bobo-Dioulasso, Burkina Faso.

For general stock-keeping purposes, Ac(DSM)2 was reared in a dedicated and highly secured climate-controlled room at a temperature fixed at 27.4°C (±0.2, 95% Confidence intervals) and a relative humidity of 76.3% (±3.2, 95% CIs). Rearing rooms have natural light via windows and were supplemented with an artificial lighting regime of LD 12/12h photoperiod, including dusk (1h) and dawn (1h). Larvae were reared in plastic trays (20×30cm) with 1l of deionized water and fed with an optimised larvae diet regime⁵³. When mosquito larvae reached their level 3 instar (L3) larvae stage they were sorted manually between transgenic and non-transgenic mosquito larvae using a fluorescent stereomicroscope (Olympus SZX7, 2-8 Honduras street, London, United Kingdom) and put in separated trays to continue their development till pupation. At the pupal stage a second round of sorting occurred to separate male and female (sexing) from both strains. The sexing was done under a basic stereomicroscope (Olympus SZX7 basic, 2–8 Honduras street, London, United Kingdom) using a thin soft brush. Pupae from each strain and sex were placed in small plastic cups inside separate fresh adult cages to emerge. Adults were kept in 30×30×30cm insect cages (produced locally) and continuously supplied with 10% (w/v) glucose solution (made with deionized water). Each generation, adult female transgenic mosquitoes were mated with male mosquitoes from the wild-type colony and blood-fed with fresh rabbit’s blood, using a membrane feeder (Hemotek^® feeder, Hemotek Ltd, Blackburn United Kingdom). Gravid females were allowed to oviposit in plastic Petri dishes containing a wet sponge covered with filter paper. Eggs were collected and hatched in plastic trays. First instar larvae (L1) were then redistributed into several trays to keep similar larvae abundance (about 250 L1 larvae per tray).

In accordance with Mendelian inheritance, stock-maintenance crosses between Ac(DSM)2 females and wild type colony males are expected to generate ~50% hemizygous transgenic male and female progeny referred to as Ac(DSM)2 and 50% non-transgenic sibling with a wild-type phenotype referred to as WT-Ac(DSM)2. That the actual phenotypic proportions matched the expected ratio was checked at each generation a part of standard procedures of colony maintenance.

Production, sexing, marking and transport of release mosquitoes

Released males were derived from the 41st backcross generation from strain importation. Assuming Mendelian inheritance, the proportion of residual non-local genetic background after so many generations would be negligible (= 0.5⁴¹).

In rearing the release mosquito cohort, some changes were made in the stock-keeping procedure to maximise the fitness of male mosquitoes to be released. These changes aimed to minimise male mosquito handling during the entire process (rearing, sorting, marking and transport). Crucially, no transgenic versus non-transgenic sorting was done at larval stage resulting in a mix of transgenic and non-transgenic sibling males in the release generation. Additionally, to minimise the number of transgenic female mosquitoes released during the study, male versus female sexing was done at both pupae (initial) and adult (complementary) stages leading to a very high sorting accuracy (over 99.5%). Pupae sexing followed the procedure described for stock maintenance. Next, adult sexing focused on removing the few females resulting from errors in pupal sexing. It consisted of removing those rare females from male mosquito cages through inspection by eye of cages and in using a heat source to attract females. Once spotted, these were removed from male release cages using a mouth aspirator.

After pupae sexing, male pupae were placed in 25×25×25cm emergence cages (made locally and specially designed to fit dimensions of the secured coolboxes used for secure transportation) at a density of ~1400 pupae per cage. Following adult emergence, and over the following days, the cages were inspected by eye daily to check for and remove any females that had not been detected during the pupae sexing process. This procedure led to a total of 15,384 male mosquitoes aged 3–7 days have emerged in 15 cages and ready for marking and release purposes. Screening of ~50 males randomly picked from each emergence cage was conducted in the ACL2 insectary and revealed a slight bias in favour of WT-Ac(DSM)2 sibling males while Ac(DSM)2 male represented 43.3% (39.7–46.9, 95% CIs) of all emerged males. Based on this genotypic ratio, it was estimated that the male release cohort was equivalent to about 6659 transgenic male mosquitoes Ac(DSM)2 and 8725 non-transgenic sibling mosquitoes called WT-Ac(DSM)2 sibling. All males were kept untouched and in the same cages throughout the whole process until being released.

The marking process was performed inside the ACL2 insectary facility, and was carried out the day before field release to allow enough time for mosquito recovery, rest and feeding. The environmental conditions were similar to those used during mosquito production. The mosquitoes were marked directly in their cages by using a cloud dye dusting technique. Aside from being fast, this highly efficient marking procedure (100% of mosquitoes successfully marked) was developed to allow the dust-marking of males in their original emergence cages, thereby avoiding male handling and damage during the marking process. This marking technique consisted of injecting pressurised red fluorescent colour powder (Bioquip^® Gladwick Rancho Dominguez, CA 90220, USA; Ref: 1162R) into the cages by using a 5ml syringe and needle to create a cloud of powder. The cages were wrapped with aluminium foil on all sides to prevent the dust from escaping through the meshed walls. Forceful injection of small amounts of powder from different sides of the cages through the aluminium cover and side netting created a dense cloud of fluorescent powder inside the cages to mark all the mosquitoes. Following marking, sugar-water was available ad-libitum to all marked mosquitoes until field release.

About 2h before the release time, the marked mosquitoes within the mosquito cages were transferred from the IRSS insectary to the release site in Bana village. Before leaving the IRSS insectary, the mosquito cages were covered by a second layer of mosquito net for security purposes. The cages were then wrapped with damp towels and placed in lockable cool boxes dedicated to their transport into the field. After having been secured, the cool boxes containing marked mosquitoes were transported to the release site. The entire process complied carefully with all regulatory requirements related to the permissions received for maintenance, handling and the release of these genetically modified organisms in Burkina Faso.

Release phase

All marked mosquitoes were released on the same day at around 5pm (about one hour before swarming) in the centre of Bana village by opening the travel cages and allowing free exodus. Mosquitoes that did not leave were counted and subtracted from the released total (n=534, 3.5%). Taking into account mortality and based on the ratio of Ac(DSM)2 and their siblings previously established, a total of 14,850 male mosquitoes were effectively released, with estimated numbers of 6428 hemizygous transgenic male A. coluzzii mosquitoes Ac(DSM)2 and 8422 non-transgenic WT-Ac(DSM)2 siblings.

Recapture phase

Mosquito recapture activities started the same day of release (about 2h after mosquito release) and took place daily for a period of 20 days after release. Two different recapture methods were used: swarm collections using sweep nets (SWN) and pesticides spray catches (PSC) inside houses.

Swarm sampling started on the evening of the release day using a well-established sweep net collection method^47,54. Previous surveys in the same village⁴¹ had allowed mapping of swarm location or natural markers where swarming repeatedly occurs. To ensure sampling across the whole study area, a stratified randomised sampling procedure was used to select and sample 15 mosquito swarms daily at dusk using the sweep net collection method. The area of Bana village and Bana Marché were divided in six and four zones, respectively. Zone 1 and 2 in Bana Village are areas of high swarm abundance and the design ensured that these were not over-represented in swarm collections. Each evening, the teams of capturers set-out to collect up to five swarms per zones depending on swarm availability (swarms are fewer and smaller in early July than later in the month). All mosquitoes captured in the swarms were transported in their sweep nets to the field laboratory and frozen until the next morning for processing. At this stage, a random sample of 15 swarms each day was picked for dust screening and genetic analyses.

Pyrethroid spray catches started the morning following the release and continued for 19 days. A set of 20 compounds were sampled each day. The sampling design followed that established in baseline studies leading to the release and in previous MRR studies⁴¹. Ten of the compounds were selected completely randomly and the other ten are a fixed set of compounds distributed regularly across the whole village. For each compound selected, a single room (1 sleeping room) within one of the house of compound was chosen for sampling. Although some compounds were selected more than once during the recapture period days, a different room (from a different house inside the same compound when applicable) was selected and no room was sampled twice during the survey period.

Pyrethroid spray catches started the morning following the release and continued for 19 days. A set of 20 compounds were selected randomly each day. For each compound selected, a single room (sleeping room) was chosen for sampling. Although some compounds were selected more than once during the seven days, a different room (from a different house inside the same compound when applicable) was selected and no room was sampled twice during the survey period.

Captured mosquitoes were identified morphologically in the field using adult anopheline morphological identification keys developed by Holstein⁵⁵ and a field stereomicroscope (Perfex Sciences^® Zoom Pro, Reference: S0852Z5 Toulouse, France). All An. gambiae s.l. mosquitoes were counted, checked for fluorescent dust marking using a Biofinder portable ultraviolet illuminator (Vansky, Shenzhen, China) and preserved in 80% ethanol. The identification of each marked mosquito was confirmed independently by two well-trained members of the staff before conservation in individual 1.5ml storage microtubes for further analysis. The non-dusted wild Anopheles mosquitoes were pooled (10 individuals per tube) and stored in similar conditions. The location of each collection was recorded and mapped using a GPS (Garmin GPS) device, series GPSMAP^®62.2.3. For all recaptured mosquitoes, we calculated the straight line distance from the release point to the recapture location using a Euclidean dispersal distance⁵⁶. In the present case, the space was assimilated to a two-dimensional orthogonal axis system where x_l and y_l represent the coordinates of the release point and x_r and y_r represent the coordinates of the recapture point⁵⁶. Calculation of the estimated flight distance of the mosquitoes then used the following formula:

Ac(DSM)2 male identification

Molecular analysis of recaptured marked mosquitoes was performed by PCR, to identify the Ac(DSM)2 strain and distinguish them from their non-transgenic WT-Ac(DSM)2 siblings. This PCR analysis consisted of detecting the integration of the eGFP::I-PpoI of the DSM transgene which characterised the transgenic mosquito strain Ac(DSM)2_. In addition, a molecular species-diagnostic was performed concomitantly using the PCR technique based on the detection of SINE 200× locus⁵⁷ and this PCR served as a control for DNA integrity. Each mosquito was split into two parts (abdomen and thorax) using forceps. The abdomen was used for the PCR and processed for DNA extraction using ‘squish’ buffer (PCR reaction buffer). The thorax was stored in 80% ethanol at −20°C. For each mosquito analysed, the same DNA extract was used for both eGFP::I-PpoI transgene detection (identification of Ac(DSM)2 transgenic mosquito) and SINE 200X locus detection (for specie identification and DNA quality control). The Ac(DSM)2 construct was detected using the primers: pBacR-fwd [ATCGGTCTGTATATCGAGGTTTATT] and pBacR-Rev [CTCTAATATTTTGCCAAATGAAGTGCC] targeting the piggyBacR region required for insertion of the transgene. PCR reactions used the Gotaq^® PCR kit (GoTaq^® G2 Flexi DNA Polymerase, reference: M829B, Promega Corporation, 2800 Woods Hollow Road·Madison, WI 53711-5399, USA).

Monitoring of Ac(DSM)2 non-persistence

Monthly mosquito collections were carried out using PSC and swarm sampling to confirm the disappearance of the Ac(DSM)2 transgene from the release site. Monitoring collections were conducted monthly for seven months. This period of monitoring was justified by the regulatory requirement of describing the Ac(DSM)2 disappearance through failure to detect the Ac(DSM)2 transgene for a minimum period of three consecutive months and with high statistical power. During each month of survey, a randomised selection of 20 houses (one room per house) and 20 swarms was sampled. All collected mosquitoes were identified morphologically using identification keys and a field stereomicroscope. Mosquitoes from A. gambiae complex were counted and preserved in 80% (v/v) ethanol for subsequent molecular identification. Each month, a representative sample of collected mosquitoes (up to 300 when available, from both PSC and swarm sampling) was analysed using the Ac(DSM)2-specific and species-specific PCR diagnostics described above to detect whether any A. gambiae s.l. mosquitoes were carrying the DSM transgene.

Bayesian inference of mosquito survival, movement and population size

We fitted the recapture data to a diffusion model to further investigate dispersal and survival of the marked Ac(DSM)2 and their sibling males, and also to estimate the number of mosquitoes in the background population. This model assumes that the released mosquitoes tend to move in a random manner, meaning they repeatedly take short randomly directed flights that are independent of one another and of the environment. As described below, however, our estimation procedure does also allow for small additional movements where mosquitoes are attracted into nearby swarms at swarming time (dusk), or nearby houses for resting behaviour.

We write the diffusion equation as

where $u\left(x,t\right)$ is the probability density of the location of a single marked mosquito at location $x$ and time $t$, conditional on the individual being alive, and $D$ is the diffusion coefficient. Assuming a point release at time $t=0$, the above equation has solution

where $r$ is the distance from the release point. We next assume that the released mosquitoes have a constant survival probability of $s$ per day, so that the expected number of extant released mosquitoes on day $d$ is $R{s}^d$ where $R$ is the number that were released. The expected number of released mosquitoes in a small area $dA$ is then given by

We take three further steps to convert this equation for $q\left(r,t\right)$ into a likelihood function for the spatio-temporal distribution of recaptures of either Ac(DSM)2 or their sibling males. First, we pool the recaptures on a given day, and made by a given method (either swarm sampling or PSC), by partitioning the study area into annuli centred on the release location. These annuli are the recapture regions, and the expected number of extant marked mosquitoes in a given annulus is the integral of $q\left(r,d\right)$ over that annulus. This step, therefore, averages out the expected number of marked mosquitoes from the inner to the outer radius of each annulus, and the annulus widths set the scale at which small movements towards swarms or houses, where mosquitoes may be recaptured, are assumed to occur in addition to random movements that underpin the diffusion model. We set the width of each annulus to 50m, based on our judgement that this distance balances the capacity to separate recaptures at different distances (this capacity reduces with width), with the confidence that movements towards swarms or houses will largely remain within annuli (this confidence increases with width).

Second, we assume the observation probability of mosquitoes in a given sample (representing an annulus, capture method, and day), is the number of unmarked mosquitoes in the sample divided by the (unknown) unmarked population size in that annulus. The unmarked population is assumed to have a uniform density, that we will infer alongside the mobility and survival parameters. Finally, we assume the number of marked mosquitoes in a given sample is Poisson-distributed around the expected number.

For the data from each recapture method, we used the likelihood function to sample a posterior distribution for the diffusion coefficients and survival rates of the two types of released male mosquitoes, and the density of the unmarked population. We assumed uniform priors with respect to all five parameters and used a Markov chain Monte Carlo algorithm based on Metropolis-Hastings sampling to sample the posterior distribution directly from the log-likelihood. For each analysis (swarm or PSC), we sampled for 100,000 iterations, of which we discarded the initial 20,000 as a transient and thinned the remainder by 100, giving 800 samples in total.

Statistical analysis

Data were analysed using the software JMP 14 (SAS Institute, Inc.). All data were checked for deviations from normality and heterogeneity, and analyses were conducted using parametric and non-parametric methods as appropriate. General linear modelling with Poisson distribution was used to describe male recaptures as a function of genotype and time. Kruskall-Wallis and Mann-Whitney test was used to describe respectively male participation in swarm and Euclidian dispersal distances. General linear modelling with Poisson distribution was used to describe male recaptures as a function of genotype and time. Estimates of population size, survival, and mobility were calculated using a Bayesian approach as described above.

The authors thank Carol Stimpson for checking the formatting and checking the language of the manuscript, Target Malaria which receives core funding from the Bill and Melinda Gates Foundation and Open Philanthropy. Related Manuscripts: The results presented herein are based on the same data and results reported to the National Biosafety Agency of Burkina Faso. Herein, they are further analysed and presented in a manner compatible with the requirements of peer-reviewed publishing.