Metabolite levels

Relative enrichment of specific metabolites was analyzed by Liquid Chromatography-Mass Spectrometry (LC–MS) to define metabolic profiles and a heatmap for intermediates of glucose metabolism is presented in Fig. 2A. Hypoxic conditions resulted in reduced D-glucose and increased glucose-6-P (all p<0.05), indicating a shift to greater glucose consumption and enhanced glycolysis (Fig. 2B). Levels of D-ribulose 5-P were also higher under hypoxia than under normoxia (p<0.05; Fig. 2C), indicating enhanced pentose phosphate pathway (PPP) activity. By contrast, levels of citrate, isocitrate, succinate, fumarate, malate and oxaloacetate (OAA) were all lower under hypoxia than under normoxia (all p<0.05, Fig. 2D), suggesting reduced TCA cycle activity under conditions of 1% O₂.

Open in a separate window

Figure 2

Glucose metabolic profiles and ¹³C tracing of intermediates of glucose metabolism. (A) Heatmap of intermediates of glucose metabolism detected by LC–MS (C1~C5: case 1~case 5). (B–D) Targeted analysis of abundance of different metabolites in major glucose-dependent metabolic pathways: glycolysis (B), PPP (C) and TCA cycle (D) using LC–MS (n=5). (E–G) HPLC-QE-MS detection of ¹³C tracing carbon flow into intermediates of glycolysis (E), PPP (F) and TCA cycle (G). M+represents the number of carbons labeled with ¹³C (n=4). Data are presented as Mean±SEM. *p<0.05 versus BM EPCs under normoxia.

¹³C glucose tracing

To ensure that the metabolites listed above originated from free glucose (rather than from gluconeogenesis, for example), stable isotope labeling experiments using ¹³C-labeled glucose were performed and isotopic enrichment quantified by High Pressure/Performance Liquid Chromatography-Q-Exactive-Mass Spectrometer (HPLC-QE-MS). No differences were found in ¹³C-labeled glycolytic intermediates, such as m+3 or m+6 iso-topologues of glucose 6-P, phosphoenolpyruvate or pyruvate, between the two conditions (Fig. 2E). However, there was a significant increase in ¹³C-labeled intermediates of the PPP, such as m+6, m+5 or m+7 iso-topologues of 6-phosphogluconate, ribose 5-P and sedoheptulose 7-P (all p<0.05), in hypoxic cells (Fig. 2F). Moreover, decreased ¹³C-labeling of TCA cycle intermediates, such as m+2 iso-topologues of citrate, succinate and malate (all p<0.05), was seen under hypoxia, suggesting a reduced contribution of glucose carbon to TCA cycle activity (Fig. 2G). Non-glucose-derived metabolites (m+0 iso-topologues) of glycolysis, PPP and TCA cycle showed no significant differences between the two conditions. The above findings indicate greater flow of glucose carbon to the PPP and reduced flow to the TCA cycle under hypoxic conditions.

Effects of glycolytic inhibition on BM EPCs proliferation

Key enzymes of pathways of glucose metabolism were inhibited and effects on cell stemness assessed.

Bromopyruvate acid (BP) was used to inhibit hexokinase II (HK II), the 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase (PFKFB3) inhibitor, compound 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one (3PO), to reduce fructose-2,6-bisphosphate (Fru-2,6-BP) levels and inhibit phosphofructokinase (PFK) and PKM2-IN-1 to inhibit pyruvate kinase (PKM2) (Fig. 3A)^13–15. BP reduced EPC proliferation under both hypoxic and normoxic conditions and colony forming capacity was almost totally abolished by 100uM BP (Fig. 3B). 3PO reduced EPC proliferation under both hypoxic and normoxic conditions and colony forming capacity was almost totally abolished by 20uM 3PO (Fig. 3C). PKM2-IN-1 reduced EPC proliferation under both hypoxic and normoxic conditions and colony forming capacity was almost totally abolished by 10uM PKM2-IN-1 (Fig. 3D). These data demonstrate that glycolysis is essential for BM EPC proliferation.

Open in a separate window

Figure 3

Inhibition of glycolysis reduced BM EPCs proliferation and inhibition of key enzymes of the PPP inhibited BM EPCs proliferation. (A) Schema for three key glycolytic enzymes, HK II, PFK and PKM, and their respective inhibitors, BP, 3PO and PKM2-IN-1. Schema for PPP enzyme, G6PD, and its respective inhibitor, 6AN. (B) Proliferation assay of BM EPCs treated with vehicle or various concentrations of BP under normoxia or hypoxia (n=6). The number of EPC colonies in the presence of 100uM BP was significantly lower than that of the vehicle controls both under normoxia and under hypoxia (n=6). (C) Proliferation assay of BM EPCs treated with vehicle or various concentration of 3PO under normoxia or hypoxia (n=6). The number of BM EPCs colonies in the presence of 20uM 3PO was significantly lower than that of the vehicle controls both under normoxia and under hypoxia (n=6). (D) Proliferation assay of BM EPCs treated with vehicle or various concentration of PKM2-IN-1 under normoxia or hypoxia (n=6). The number of BM EPCs colonies in the presence of 10uM PKM2-IN-1 was significantly lower than that of the vehicle controls both under normoxia and hypoxia (n=6). (E) Proliferation assay of BM EPCs treated with vehicle or various concentrations of 6AN under normoxia or hypoxia (n=6). (F) The number BM EPCs colonies in the presence of 20uM 6AN was significantly lower than that of the vehicle controls both under normoxia and under hypoxia (n=6). (G) Representative experiment showing ECAR of BM EPCs and comparison of glycolytic rate and capacity in BM EPCs treated with or without of 6AN under normoxia (n=6). (H) Representative experiment showing OCR of BM EPCs and comparison of the OCR of basal and maximal respiration in the presence or absence of 6AN under normoxia. (I) Representative experiment showing ECAR of BM EPCs and comparison of glycolytic rate and capacity in the presence or absence of 6AN under hypoxia. (J) Representative experiment showing OCR of BM EPCs and comparison of basal and maximal respiration in the presence or absence of 6AN under hypoxia. Data are presented as Mean±SEM. *p<0.05; **p<0.01; ***p<0.001 versus vehicle control (with or without DMSO).

Effects of PPP inhibition on BM EPCs proliferation

PPP activity is vital for anabolic biosynthesis and anti-oxidant defense¹⁶ and depends on the diversion of glucose carbon away from the glycolytic pathway. Glucose-6-phosphate dehydrogenase (G6PD) is considered to be a key rate-controlling enzyme of the PPP and can be competitively inhibited by 6-AN (Fig. 3A)¹⁷. 6-AN reduced BM EPCs proliferation in a dose-dependent manner both under normoxia and under hypoxia (Fig. 3E) and colony formation in the presence of 20uM 6-AN was significantly lower than that of the vehicle controls (both p<0.05; Fig. 3F).

6-AN did not affect glycolytic rate and capacity under normoxia (both p>0.05; Fig. 3G) but reduced basal (p<0.01) and maximal respiration (p<0.05; Fig. 3H). No significant differences in glycolytic rate or capacity (both p>0.05; Fig. 3I) or in basal or maximal respiration (p>0.05, Fig. 3J) were seen with 6-AN under hypoxic conditions.

Promotion of pyruvate oxidation reversed the effect of hypoxia in maintaining cell stemness

Pyruvate dehydrogenase (PDH) catalyzes the irreversible oxidative decarboxylation of the glycolytic product, pyruvate, to the TCA cycle substrate, acetyl coenzyme A and flux through PDH, is negatively regulated by pyruvate dehydrogenase kinase (PDK) enzymes which may be inhibited by the compound, AZD7545 (Fig. 4A)^18,19. Inhibition of PDK1, PDK2 and PDK3 by AZD7545, with the resulting stimulation of pyruvate oxidation^20,21, suppressed cell proliferation (Fig. 4B), reduced colony formation (p<0.01; Fig. 4C) and reduced expression of Nanog, Oct4, Klf4 and Sox2 (Fig. 4D) under hypoxic conditions. Glycolytic rate and capacity decreased (both p<0.01, Fig. 4E) and basal and maximal respiration increased (both p<0.05; Fig. 4F) under the same conditions. Use of AZD7545 under normoxic conditions produced the opposite results (Supplemental Fig. ¹F–J). Overall, it appears that the promotion of pyruvate oxidation resulting from use of AZD7545 reversed the effects of hypoxia in maintaining stemness.

Open in a separate window

Figure 4

Effects of UK5099 and AZD7545 on BM EPCs stemness under normoxia and hypoxia, respectively. (A) Schema showing that the MPC inhibitor, UK5099, decreases pyruvate entry into the TCA cycle and that PDK inhibition by AZD7545 increases pyruvate oxidation. (B) Proliferation assay of BM EPCs treated with vehicle or various concentration of AZD7545 under hypoxia (n=6). (C) Colony formation assay of BM EPCs treated with vehicle or 20uM AZD7545 under hypoxia (n=6). (D) qRT-PCR showed lower expression of BM EPCs stemness markers in the presence of 20uM AZD7545 than with vehicle control under hypoxia (n=5). (E) Representative experiment showing ECAR of BM EPCs and comparison of glycolytic rate and capacity in the presence or absence of AZD7545 under hypoxia (n=6). (F) Representative experiment showing OCR of BM EPCs and comparison of basal and maximal respiration in the presence or absence of AZD7545 under hypoxia (n=6). (G) Proliferation assay of BM EPCs treated with vehicle or various concentrations of UK5099 under normoxia (n=6). (H) Colony formation assay of BM EPCs treated with 20uM UK5099 or vehicle under normoxia (n=6). (I) qRT-PCR showed higher expression of BM EPCs stemness markers in the presence of 20uM UK5099 than with vehicle control under normoxia (n=5). (J) Representative experiment showing ECAR of BM EPCs and comparison of the glycolytic rate and capacity in the presence or absence of UK5099 under normoxia (n=6). (K) Representative experiment showing OCR of BM EPCs and comparison of basal and maximal respiration in the presence or absence of UK5099 under normoxia (n=6). Data are presented as Mean±SEM. *p<0.05; **p<0.01; ***p<0.001 versus DMSO vehicle control.

Inhibition of pyruvate oxidation promoted cell proliferation under normoxia

The glycolytic product, pyruvate, is transported into the mitochondrion by the mitochondrial pyruvate carrier (MPC) for further oxidation. UK5099 is a potent inhibitor of MPC (Fig. 4A)²². Under normoxic conditions, 20 uM UK5099 promoted cell proliferation (p<0.01; Fig. 4G) and, although colony formation was unaffected (p>0.05; Fig. 4H), Nanog, Oct4, Klf4 and Sox2, were all upregulated (all p<0.05; Fig. 4I). Moreover, glycolytic rate (p<0.05) and capacity (p<0.001) were both higher in the presence of UK5099 (Fig. 4J) and basal (p<0.05) and maximal respiration rates (p<0.01) were both lower (Fig. 4K). By contrast, UK5099 had little effect on cell proliferation, glycolytic rate and capacity, basal or maximal respiration under hypoxic conditions (Supplemental Fig. ¹A–E). In combination, the above data suggest that inhibition of pyruvate oxidation promotes glycolysis, reduces mitochondrial respiration and increases BM EPCs proliferation under normoxia.

Inhibition of the TCA cycle promoted cell proliferation under normoxia

Citrate synthase (CS), isocitrate dehydrogenase 3 (IDH3), and α-ketoglutarate dehydrogenase (KGDHC) all catalyze irreversible steps in the TCA cycle. Palmitoyl-coenzyme A (PCA) inhibits CS by interacting with the enzyme’s small domain^23,24. Succinyl phosphonate trisodium salt (SP) inhibit KGDHC isoforms from muscle, bacteria, brain and cultured human fibroblasts (Fig. 5A)^25,26. No chemical inhibitor of IDH3 was found.

Open in a separate window

Figure 5

Inhibition of key TCA cycle enzymes increased cell proliferation under normoxia. (A) Schema for two enzymes, citrate synthase and KGDHC, in the TCA cycle and their respective inhibitors, PCA and SP. (B) Proliferation assay of BM EPCs treated with vehicle or various concentrations of PCA under normoxia (n=6). (C) Colony formation assay of EPCs treated with vehicle or 10uM PCA under normoxia (n=6). (D) qRT-PCR showed higher expression of BM EPCs stemness markers in the presence of 10uM PCA than with vehicle control under normoxia (n=5). (E) Representative experiment showing ECAR of BM EPCs and comparison of glycolytic rate and capacity in the presence or absence of PCA under normoxia (n=6). (F) Representative experiment showing OCR of BM EPCs and comparison of basal and maximal respiration in BM EPCs in the presence or absence of PCA under normoxia (n=6). (G) Proliferation assay of BM EPCs treated with vehicle or various concentration of SP under normoxia (n=6). (H) Colony formation assay of BM EPCs treated with vehicle or 20uM SP under normoxia (n=6). (I) qRT-PCR showed higher expression of BM EPCs stemness markers in the presence of 20uM SP than with vehicle control under normoxia (n=5). (J) Representative experiment showing ECAR of BM EPCs and comparison of glycolytic rate and capacity in the presence or absence of SP under normoxia (n=6). (K) Representative experiment showing OCR of BM EPCs and comparison of basal and maximal respiration in the presence or absence of SP under normoxia (n=6). Data are presented as Mean±SEM. *p<0.05; **p<0.01 versus vehicle control (with or without DMSO).

TCA cycle inhibition by PCA promoted cell proliferation under conditions of normoxia (Fig. 5B), although colony formation was unaffected (p>0.05, Fig. 5C). Expression of Nanog, Oct4, Klf4 and Sox2 was upregulated when PCA was present (all p<0.05; Fig. 5D). Moreover, use of PCA increased glycolytic rate and capacity (both p<0.05; Fig. 5E) and decreased basal (p<0.05) and maximal respiration (p<0.01; Fig. 5F) compared with controls. Very similar results were obtained with SP (Fig. 5G–K). Thus, inhibition of the TCA cycle increases flux through glycolysis and proliferation under normoxic conditions. By contrast, use of PCA or SP had little effect on cell proliferation, glycolytic rate and capacity, basal or maximal respiration under hypoxic conditions (Supplemental Fig. ²). The implication from these data is that the TCA cycle may already be maximally suppressed under hypoxic conditions and further inhibition has little detectable effect.

Inhibition of the ETC

The complex III inhibitor, antimycin A (AA) was used to block the ETC²⁷. Use of AA promoted BM EPCs proliferation (Fig. 6A) under normoxic conditions, although there was a significant reduction in colony formation (p<0.05; Fig. 6B). Production of Oct4 and Klf4 mRNA (both p<0.05; Fig. 6C) and glycolytic rate (p<0.05; Fig. 6D) were all stimulated and maximal respiration (p<0.001; Fig. 6E) reduced compared with controls. By contrast, use of AA had little effect on cell proliferation, glycolytic rate and capacity, basal or maximal respiration under hypoxic conditions (Supplemental Fig. ³).

Open in a separate window

Figure 6

ETC inhibition promoted cell proliferation under normoxia. (A) Proliferation assay of BM EPCs treated with vehicle or various concentration of AA under normoxia (n=6). (B) Colony formation assay of BM EPCs treated with vehicle or 200 nM AA under normoxia (n=6). (C) qRT-PCR showed higher expression of BM EPCs stemness markers in the presence of 200 nM AA than with vehicle control under normoxia (n=5). (D) Representative experiment showing ECAR of BM EPCs and comparison of glycolytic rate and capacity in the presence or absence of AA under normoxia (n=6). (E) Representative experiment showing OCR of BM EPCs and comparison of basal and maximal respiration in the presence or absence of AA under normoxia (n=6). Data are presented as Mean±SEM. *p<0.05; **p<0.01; *** p<0.001 versus DMSO vehicle control.

Colony formation assay

BM EPCs were seeded onto 6-well plates (100 cells per well) and incubated under normoxia/ hypoxia for 24 h. 30 μL of different concentrations of inhibitors or vehicles (with or without DMSO) were added and incubated under normoxia / hypoxia conditions for 8 days. Cells were washed twice with phosphate buffered saline (PBS) and fixed with 1 mL 4% paraformaldehyde for 15 min and incubated with 1 mL 0.1% crystal violet for 20 min. Excess crystal violet was washed off with dH₂O and dishes allowed to dry. Photographs were taken and the colonies containing>50 individual cells counted.

Quantitative real-time PCR (qRT-PCR)

Total RNA was isolated using Trizol reagent (Invitrogen, USA) and cDNA synthesized using Evo M-MLV RT Kit with gDNA Clean for qPCR (Accurate Biology AG, hunan, China). qRT-PCR was performed with SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology AG, hunan, China) on an ABI QuantStudio™ 3 System Real-Time PCR System (Applied Biosystems, USA). Primers for genes encoding β-actin, Nanog, OCT4, Sox2 and KLF4^53,54 were purchased from Ige biotechnology ltd. Primer sequences were as follows: Human β-actin: forward 5′-AGCGAGCATCCCCCAAAGTT-3′; reverse 5′-GGGCACGAAGGCTCATCATT-3′; Human Nanog: forward 5′-AATGTCTTCTGCTGAGATGCCT-3′; reverse 5′-GAAGTGGGTTGTTTGCCTTTGG -3′; Human OCT4: forward 5′-TGGGAAGGTATTCAGCCAAACG -3′; reverse 5′- CACGAGGGTTTCTGCTTTGCAT -3′; Human Sox2: forward 5′- CATCACCCACAGCAAATGAC -3′; reverse 5′- CAAAGCTCCTACCGTACCACT -3′; Human Klf4: forward 5′- CATCTCAAGGCACACCTGCGAA -3′; reverse 5′-TCGGTCGCATTTTTGGCACTGG -3′. qRT-PCR was performed in duplicate in a 20-μl reaction volume. Fold differences were determined using β-actin as an internal reference by the 2^−Ct method.

Tube formation assay

The tube formation assay was carried out to estimate the angiogenic capacity of BM EPCs. Briefly, EPCs (3×10⁴cells) were seeded onto 96-well plates coated with growth factor-reduced matrigel (70 μl/well; BD Biocoat) and cultured in EBM-2 at 37 °C under hypoxia or normoxia. After incubation for 8 h, tubes in each well were visualized under an inverted microscope, photographed at 10×magnification, and analyzed using the Angiogenesis Analyzer for ImageJ software.

Extracellular flux analysis

Kinetic metabolic profiling was performed in real time by the fully integrated 96-well Seahorse Bioscience Extracellular XFe96 Flux Analyzer (Seahorse Bioscience, North Billerica, MA). Extracellular acidification rate (ECAR) to measure glycolytic capacity was determined using the XF Glycolysis Stress Test Kit (Seahorse Bioscience, North Billerica, MA) and oxygen consumption rate (OCR) to reflect mitochondrial respiration using the XF Cell Mito Stress Test Kit (Seahorse Bioscience, North Billerica, MA).

BM EPCs were prepared by seeding 2×10⁴ cells per well into a XFe96 Microplate (Seahorse Bioscience, North Billerica, MA) and incubating under normoxia/ hypoxia for 24 h. Cells were washed twice with PBS and incubated in pH 7.4 Seahorse XF Assay Medium for 1 h at 37 °C without CO₂. Inhibitors or vehicle were added to through hole A of the feeding hole. Metabolic profiles were determined by adding glucose (10 mM), oligomycin (2 μM) and 2-DG (50 mM) for ECAR; oligomycin (2 μM), carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP, 2 μM), rotenone/antimycin A (1 μM) for OCR (all Seahorse Bioscience, North Billerica, MA).

LC–MS conditions for metabolite detection

LC–MS/MS analyses were performed using an ExionLC™ AD system (SCIEX) coupled with a QTRAP^® 6500+mass spectrometer (SCIEX). 1×10⁷ BM EPCs (50 μL). Pre-chilled 80% methanol (200 μL) was vortex mixed and sonicated for 6 min. Samples were incubated on ice for 5 min before centrifugation at 15,000 rpm, 4 °C for 10 min. Supernatant was diluted to the final concentration by addition of LC–MS grade water containing 53% methanol. Samples were transferred to a fresh Eppendorf tube and centrifuged at 15,000 g at 4 °C for 20 min. Filtrate was injected into the LC–MS/MS system via a Waters Atlantis premier BEH C18 Column (2.1×100 mm) using a 10-min linear gradient at a flow rate of 0.3 mL/min. Eluents were A: 0.5% formic acid/30 mM ammonium formate and B: 0.5% formic acid–methanol). The solvent gradient was set as follows: 0% B for 2 min; 0–100% B for 2.01 min; 100% B for 6 min; 100–0% B for 8.01 min; 0% B for 10 min. QTRAP^® 6500+mass spectrometer was operated in positive polarity mode with Curtain Gas of 35 psi, Collision Gas of Medium, IonSpray Voltage of 4500 V, Temperature of 550 °C, Ion Source Gas 1:60, Ion Source Gas 2: 60 and in negative polarity mode with Curtain Gas of 35 psi, Collision Gas of Medium, IonSpray Voltage of − 4500 V, Temperature of 550 °C, Ion Source Gas 1:60, Ion Source Gas 2:60. Detection of experimental samples used MRM (Multiple Reaction Monitoring), based on novogene in-house database. Q3 was used for metabolite quantification. Q1, Q3, RT (retention time), DP (declustering potential) and CE (collision energy) were used for metabolite identification. Data files generated by HPLC–MS/MS were processed using SCIEX OS Version 1.4 to integrate and correct the peak.

¹³C tracing by HPLC-QE-MS

Cells were cultured under normoxia/ hypoxia and culture medium replaced with labeling medium containing 2 g/L [U6]-¹³C-glucose (Sigma) followed by incubation for 24 h. 250 μL of water was added to 1×10⁵ EPCs followed by vortex mixing for 30 s. Samples were pre-cooled in dry ice, freeze-thawed three times in liquid nitrogen, vortexed for 30 s and sonicated for 10 min in an ice-water bath. 750 μL of methanol was added to the sample solution with vortex mixing and vibration at 4 °C for 15 min, followed by incubation at − 40 °C for 1 h. Samples were centrifuged at 12,000 rpm (RCF=13,800(×g), R=8.6 cm) for 15 min at 4 °C. 800 μL of the clear supernatant was collected and dried in a vacuum concentrator. Residue was reconstituted with ultrapure water according to the cell count, vortexed and sonicated for 10 min in an ice-water bath before filtration through the centrifuge tube filter. Supernatant were transferred to inserts in injection vials for HPLC-QE-MS analysis.

HPLC separation was carried out using a Thermo Scientific Dionex ICS-6000 HPLC System (Thermo Scientific) equipped with Dionex IonPac AS11-HC (2×250 mm) and AG11-HC (2 mm×50 mm) columns. Mobile phase A consisted of 100 mM NaOH in water and phase C of water. An additional pumping system was used to supply the solvent (2 mM acetic acid in methanol) and solvent mixed with eluent before loading of the ion source (flow rate of 0.15 mL/min). The column temperature was set at 30 °C, that of the auto-sampler at 4 °C and the injection volume was 5 μL. The QE mass spectrometer was used to acquire MS spectra in full MS mode with acquisition software (Xcalibur 4.0.27, Thermo) to continuously evaluate the full scan MS spectrum.

Proliferation assay

BM EPCs were seeded onto 96-well plates (4000 cells per well) and incubated under normoxia or hypoxia for 1 day in a final volume of 90 μL/well. 10 μL of inhibitor or vehicle (with or without DMSO) were added to each well and incubated under conditions of normoxia/hypoxia for 3 days. 10 μL Cell Counting Kit-8 (Dojindo, Japan) mixture was added and the plate incubated for 2 h before measurement of absorbance at 450 nm by microplate reader (Thermo FC).

ATP measurement

Total ATP was measured using ATP Assay Kit (Beyotime) according to the manufacturer’s instructions. Briefly, 5×10⁵ BM EPCs were lysed with 200 μL lysis buffer and ultrasonicated after washing twice with PBS. The lysate was centrifuged at 12 000×g for 15 min at 4 °C. 20 uL per well supernatant was added to a microplate together with 100 uL ATP detection solution. Chemiluminescence was detected by a luminescence reader (Synergy H1). Mitochondrial ATP was measured by using the XF Cell Mito Stress Test Kit (Seahorse Bioscience, North Billerica, MA) by subtracting the rate measurement before oligomycin addition from that after oligomycin.

Statistical analysis

Data are presented as mean±SEM and paired Student’s t-test was used to compare parameter data, Wilcoxon test for nonparametric data and ANOVA for repeated measurement data. A value of p<0.05 was considered significant.