Cell culture, cell transfection, and establishment of stable cell lines

Human prostate epithelial cells (HPECs, cat. no. CP-H019) and PCa cell lines LNCaP (cat. no. CL-0143) and PC-3 (cat. no. CL-0185) were purchased from Procell (Wuhan, Hubei, China). All cells were cultured in RPMI-1640 medium (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37 °C with 5% CO₂.

Overexpression lentivirus (oeFAM84B, oeWWP1, oeCDKN1B) based on mammalian gene expression lentiviral vector (pLV[Exp]-EGFP:T2A:Puro-EF1A), shLig3 1, 2, 3#, shWWP1 1, 2, 3# based on mammalian short hairpin (sh)RNA interference lentiviral vector (pLV[shRNA]-EGFP:T2A:Puro-U6), and their respective controls (oeCtrl and shCtrl) were purchased from VectorBuilder (Guangzhou, Guangdong, China). The virus titer was 10⁹ TU/mL, and the corresponding lentivirus was used to infect PCa cells (multiplicity of infection=5) for 48 h. Stably transfected cell lines were subsequently screened with 2 μg/mL puromycin for 2 weeks. ShRNAs sequences specific for Lig3 and WWP1 were: shLig3 1#: CCGGATCATGTTCTCAGAAATCTCGAGATTTCTGAGAACATGATCCGG; shLig3 2#: GCCCACTTTAAGGACTACATTCTCGAGAATGTAGTCCTTAAAGTGGGC; shLig3 3#: CAGGAGTCATTAAGACTGTTTCTCGAGAAACAGTCTTAATGACTCCTG; shWWP1 1#: GACTTGAGGAGGCGCTTATATCTCGAGATATAAGCGCCTCCTCAAGTC; shWWP1 2#: CATGGAATCTGTCCGAAATTTCTCGAGAAATTTCGGACAGATTCCATG; shWWP1 3#: GCTGTTCAGAAAGGTATTAAGCTCGAGCTTAATACCTTTCTGAACAGC.

Stably transfected PCa cells were treated with MYC inhibitor MYCi361 (S8905, Selleck, Houston, TX, USA) at 6 μM for 3 h to promote MYC protein degradation [14] or Wnt signaling pathway inhibitor LF3 (S8474, Selleck) at 30 μM for 4 h to disrupt the interaction between beta catenin and TCF4. Dimethylsulfoxide (DMSO) was used as the control for both treatments.

Outward and inward PCR

To validate the circular structure of eccDNA 3#, outward PCR primers containing different junction sites of eccDNA 3# and inward PCR primers (Table 1) targeting representative intact transcripts in different segments were designed. All reactions were performed using human genomic DNA as a control, and the PCR reaction system contained a phi29 amplification template, primers, and master mix for PCR (#1665009EDU, Bio-Rad Laboratories, Hercules, CA, USA). PCR assays were performed in a PCR cycler under standard PCR conditions according to the manufacturer’s protocols, and the circular structure of eccDNA 3# was confirmed based on agarose gel electrophoresis PCR.

Western blot

Total proteins were extracted from the cells using RIPA lysis buffer (Roche Diagnostics, Co., Ltd., Rotkreuz, Switzerland) containing protease and phosphatase inhibitors. Equal amounts of protein samples were separated by 8–12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to PVDF membranes (Millipore Corp, Billerica, MA, USA). Primary antibodies were incubated overnight at 4 , followed by reprobing with the secondary antibody. Signals were subsequently enhanced with chemiluminescent reagents (Abcam, Cambridge, UK). Primary antibodies used were FAM84B (1:1000, 18421-1-AP, ProteinTech Group, Chicago, IL, USA), MYC (1:1000, #18583, Cell Signaling Technologies, Beverly, MA, USA), beta catenin (1:2000, 17565-1-AP, Cell Signaling Technologies), WWP1 (1:2000, 28689-1-AP, ProteinTech), CDKN1B (1:5000, ab32034, Abcam), beta actin (1:200, ab115777, Abcam), and ubiquitin (1:1000, #20326, Cell Signaling Technologies).

PCR analysis

Total RNA was extracted from the cells using TRIzol reagent (GK20008, Glpbio, Montclair, CA, USA). After reverse transcription with the iScript cDNA Synthesis kit (#1708890, Bio-Rad Laboratories), the SsoAdvanced Universal SYBR Green Supermix (#1725270, Bio-Rad Laboratories) was used for qPCR reactions on a CFX Opus 96 Real-Time PCR system (Bio-Rad Laboratories). The relative mRNA levels were normalized using beta actin as a control. The 2^−Ct method was used to analyze the results. The primer sequences are presented in Table 2.

Immunohistochemistry (IHC)

Paraffin-embedded tissue sections (4 μm) were dewaxed using xylene and dehydrated with gradient ethanol, followed by the addition of 3% hydrogen peroxide to block endogenous peroxidase activity. Antigen retrieval was performed by heating sections in sodium citrate buffer (pH 6.0) in a microwave oven at 100 °C for 30 min, followed by detection of immunoreactivity by the Rabbit-diaminobenzidine Detection IHC kit (IHC0007, FineTest, Wuhan, Hubei, China). Briefly, nonspecific antigen binding was blocked by blocking serum, and then the sections were stained with primary antibody overnight at 4 °C, followed by color development by DAB after incubation with poly-horseradish peroxidase-Goat Anti-Rabbit IgG at room temperature for 1 h. Hematoxylin was used to counter-stain the nuclei. Scoring was performed for clinical samples and was completed by three pathologists who were unaware of the grouping. The score was determined according to the positive staining intensity (0: negative; 1: weak; 2: moderate; 3: strong) and positive staining cells quantity: (0:<5%; 1: 5~25%; 2: 25~50%; 3: 50~75%; 4:>75%), and the final score was intensity score×quantity score (0–12). Xenograft tumor tissues were viewed by microscopy, and positively stained areas were quantified using Image J software. Antibodies to FAM84B (1:200, 18421-1-AP, ProteinTech), Ki67 (1:200, 28074-1-AP, ProteinTech), WWP1 (1:500, 28689-1-AP, ProteinTech), Lig3 (1:200, A22136, ABclonal, Wuhan, Hubei, China), MYC (1:200, #18583, Cell Signaling Technologies), and CDKN1B (1:50, ab32034, Abcam) were used.

Proliferation and viability assays

The treated PCa cells were suspended with 100 μL of the medium, seeded into 96-well plates (3000 cells/well), and incubated for the indicated periods (1, 3, 5 days). After the addition of 10 μL of Cell Counting Kit-8 (CCK8; GK10001, Glpbio) to each well, the incubation continued for 2 h in a cell incubator. The cell proliferation was measured by reading the OD value at 450 nm using a microplate reader.

The DNA synthesis of the cells was determined using the BeyoClick EdU-594 Cell Proliferation Assay kit (C0078S, Beyotime, Shanghai, China) according to the supplier’s protocol. Treated PCa cells (1×10⁴) were placed in a 96-well plate and treated with 50 μM of EdU for 2 h. Afterward, the cells were fixed in 4% paraformaldehyde in PBS for 30 min at room temperature and permeabilized with 0.5% TritonX-100 for 10 min, followed by staining with Click Additive Solution for 30 min in the dark. Hoechst 33342 was used to stain cells for 5 min in the dark to label the nucleus. Finally, the cells were observed by fluorescence microscopy (Olympus, Tokyo, Japan), and the proportion of EdU-positive cells was calculated.

Migration and invasion assays

Transwell chambers (8-μm pore size, Corning Costar, Corning, NY, USA) were used for cell migration and invasion assays. For the migration assay, 1×10⁵ treated PCa cells were seeded in the apical chamber containing serum-free medium, and a complete medium containing 10% FBS was supplemented to the basolateral chamber. After 24 h, migrated cells were fixed with 4% paraformaldehyde and stained with crystal violet. For the invasion assay, the apical chamber was precoated with Matrigel, and the rest of the steps were the same as for the migration assay.

Chromatin immunoprecipitation (ChIP) assay

The promoter sequence of MYC (chr8:127736036–127736381) and the WWP1 promoter sequence (chr8:86341669–86343512) with a potential binding relationship to MYC were obtained from the UCSC Genome Browser (https://genome.ucsc.edu/index.html). The SimpleChIP Plus Enzymatic ChIP kit (#9005, Cell Signaling Technologies) was used to detect the ability of MYC to recruit the WWP1 promoter and and the ability of beta catenin to recruit the MYC promoter. The cells were fixed with formaldehyde and then lysed, and chromatin was partially digested with micrococcal nuclease to form fragments. The chromatin fractions were incubated with antibodies to one of the following: MYC (1:100, #18583, Cell Signaling Technologies), beta catenin (1:100, 17565-1-AP, Cell Signaling Technologies), or normal rabbit IgG with ChIP-grade protein G magnetic beads. After protein–DNA was de-crosslinked, purification was performed using DNA purification centrifuge columns, and enrichment of the WWP1 promoter or MYC promoter was detected by qPCR reaction. The qPCR reaction system consisted of nuclease-free H₂O, 5 µM promoter primer, and SimpleChIP universal qPCR premix. A total of 40 cycles of the standard PCR reaction program were performed according to the manufacturer’s protocol. The signal obtained from each immunoprecipitation was expressed as a percentage of the total input chromatin: % of input=1%×2^{(Ct 1%input sample−Ct IP sample)}, Ct=Threshold cycle of PCR reaction.

Luciferase reporter assay

The WWP1 promoter sequence (chr8:86341669–86343512), which has a binding relationship with MYC or the MYC promoter sequence (chr8:127736036–127736381) was inserted into the pGL3 basic vector (Promega Corporation, Madison, WI, USA) to construct the WWP1 or MYC promoter luciferase reporter plasmid. These plasmids were transfected into treated PCa cells by Lipofectamine 2000 (Thermo Fisher Scientific Inc., Waltham, MA, USA), and the luciferase activity was assessed by a dual luciferase reporter assay system (Promega) after 48 h.

TOP/FOP flash

TOP flash plasmid (D2501, Beyotime) containing the TCF/LEF binding site was used to detect Wnt/β-catenin pathway activity in cells, and the FOP flash plasmid (D2503, Beyotime) containing the mutated TCF/LEF binding site sequence was used as a negative control. The above plasmids were transfected into the treated PCa cells by Lipofectamine 2000 (Thermo Fisher), and the luciferase activity was measured by Dual-Luciferase Reporter Analysis System (Promega Corporation, Madison, WI, USA) after 48 h.

Formation of xenografts and metastases

The protocols were approved by the Animal Research Ethics Board of Shengjing Hospital of China Medical University (approval no. 2022PS1170K; approved date 4 January 2022) following the Guidelines for the Care and Use of Animals. The study involving animals was conducted following the Basel Declaration. Seven-week-old male NOD/SCID mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and acclimatized for 1 week before the experiment. All mice were randomly divided into 12 groups of 10 mice each.

Five mice in each group were randomly selected for tumor growth experiments. The PC-3 cells were suspended in PBS at a density of 1×10⁷ cells/mL, and Matrigel (Corning) was added to the cell suspension at a ratio of 1:1. The mixture (150 μL) was injected subcutaneously into the back of mice to induce tumor growth. The tumor volume (V) was measured once a week with calipers, and the formula is as follows: V=0.5×L×W², where L=length and W=width. After 4 weeks, the mice were euthanized, and their tumor size and weight were measured.

The remaining five mice in each group were used for tumor metastasis experiments. PC-3 cells were labeled with luciferase and treated as indicated. Subsequently, 100 µL (1×10⁷ cells/mL) of the cell suspension was injected intracardially into the left ventricle. Each week, 150 µL of 30 mg/mL d-luciferin was injected intraperitoneally into each mouse, and then luciferase activity was measured using the IVIS Small Animal Live Imaging System to assess tumor metastasis. For mice requiring MYCi361 treatment, MYCi361 (55 mg/kg/day) was administered by gavage after tumor cell injection for 3 consecutive days per week for 2 weeks.

Co-immunoprecipitation (Co-IP)

PCa cells in the oeCtrl and oeWWP1 groups were pretreated with MG-132 (S2619, Selleck) at a concentration of 100 nM for 12 h to inhibit 26S proteasome-mediated protein degradation, followed by lysis in RIPA lysis buffer and centrifugation. A portion of the supernatant was used as input, and the other supernatant was immunoprecipitated with CDKN1B antibody (1:30, ab32034, Abcam) overnight at 4 °C and incubated with protein A/G agarose beads (Thermo Fisher Scientific) for 60 min at room temperature. The immune complexes were washed with RIPA buffer containing 5% Tween-80 and assayed by western blot assays.

Determination of protein stability

Cycloheximide (CHX, S7418, Selleck) was used to treat PCa cells in the oeCtrl and oeWWP1 groups at a concentration of 500 nM for 0, 3, and 6 h to inhibit protein synthesis. The cells were collected at each time point, and CDKN1B protein expression was detected by western blot assays to assess the protein stability of CDKN1B.

eccDNA-mediated overexpression of FAM84B promotes malignant progression of PCa cells

FAM84B was overexpressed by lentiviral infection in PCa cell lines with knockdown of Lig3, and lentiviral overexpression of FAM84B significantly reversed the downregulation of FAM84B induced by knockdown of Lig3 (Fig. 2A). Knockdown of Lig3 significantly inhibited PCa cell proliferation and DNA synthesis, whereas overexpression of FAM84B significantly rescued PCa cell activity (Fig. 2B, ​B,C).C). It was observed using the transwell assay that knockdown of Lig3 inhibited cell migration and invasion, while overexpression of FAM84B activated cell metastatic activity (Fig. 2D, ​D,EE).

Open in a separate window

Fig. 2

FAM84B overexpression promotes the growth and metastasis of PCa cells. PCa cells were infected with shCtrl, shLig 3 1#, shLig 3 1#+oeCtrl, shLig 3 1#+oeFAM84B. A Detection of FAM84B expression by RT–qPCR. B, C The PCa cell proliferation and DNA synthesis activity were assessed using CCK8 and EdU staining. D, E The migratory and invasion of PCa cells were assessed using transwell assays. F The growth rate of xenograft tumors formed by subcutaneously inoculated PC-3 cells in mice (n=5). G Lig3, FAM84B, and Ki67 protein expression in xenograft tumors (n=5) was examined using IHC. H Observation of tumor cell metastasis formed by intracardiac injection of PC-3 cells by bioluminescence imaging (n=5). Experiments were repeated three times with multiple wells. The bars indicate SD. *p<0.05 (one-way/two-way ANOVA). Scale bar=50 μm

More malignant PC-3 cells were used to perform xenograft experiments. Subcutaneous injection of PC-3 cells was used to induce tumor growth, and knockdown of Lig3 inhibited the growth of xenograft tumors and reduced tumor weight, which was reversed by overexpression of FAM84B (Fig. 2F). IHC confirmed reduced FAM84B expression by Lig3 inhibition in xenograft tumors and reduced expression of the proliferation marker Ki67. However, FAM84 overexpression induced Ki67 expression (Fig. 2G). PC-3 cells were intracardially injected into mice to construct an in vivo metastasis model, and the knockdown of Lig3 attenuated tumor load and reduced distant metastasis. By contrast, overexpression of FAM84B showed metastasis-promoting properties (Fig. 2H).

FAM84B promotes the expression of WWP1 in PCa

UALCAN (https://ualcan.path.uab.edu/cgi-bin/ualcan-res.pl) is a comprehensive, user-friendly, and interactive web resource for analyzing cancer OMICS data. To analyze transcriptome changes in PCa affected by eccDNA-mediated FAM84B expression, we downloaded genes co-expressed with FAM84B in PCa from UALCAN. The heatmap in Fig. 3A shows the top 25 genes in terms of the correlation coefficient. The genes with correlation coefficients greater than or equal to 0.7 (Supplementary Table 3) were subjected to Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis, and we observed that genes co-expressed with FAM84B were significantly involved in the hsa04120: Ubiquitin mediated proteolysis pathway and three genes co-expressed with FAM84B were present in this pathway: WWP1, UBE2W, and UBR5 (Fig. 3B). Analysis in GEPIA showed that the expression of WWP1 (Fig. 3C) was significantly increased in PCa, while the expression of UBE2W and UBR5 was not significantly altered in PCa (Fig. 3D, ​D,EE).

Open in a separate window

Fig. 3

Downstream target analysis of FAM84B. A The heatmap of the top 25 genes significantly and positively correlated with FAM84B expression. B Pathway enrichment analysis of FAM84B co-expressed genes. GEPIA analysis of expression of WWP1 (C), UBE2W (D), and UBR5 (E) in PCa. F The expression of WWP1 in PCa cells and HPECs was assessed using RT–qPCR. G Effect of knockdown of Lig3 and overexpression of FAM84B on WWP1 mRNA expression by RT–qPCR. H WWP1 protein expression in PCa and adjacent tissues (n=38) was examined using IHC. I The correlation of WWP1 expression and FAM84B expression in PCa tissues was analyzed using Pearson’s correlation analysis (n=38). Experiments were repeated three times with multiple wells. The bars indicate SD. *p<0.05 (paired t-test, one-way/two-way ANOVA)

RT–qPCR experiments showed that WWP1 expression was significantly elevated in the PCa cell lines (Fig. 3F). Lig3 knockdown inhibited WWP1 expression in the PCa cell lines, while WWP1 expression was significantly restored after overexpression of FAM84B (Fig. 3G). In addition, we also detected high expression of WWP1 in PCa tissues (Fig. 3H), and its expression was significantly and positively correlated with FAM84B (F​(Fiig. 3I). PCa patients were divided into two cohorts of high WWP1 expression (n=19) and low WWP1 expression (n=19) based on the mean WWP1 IHC scores in the tumor tissues (Table 4). The correlation between WWP1 expression in tumor tissues and clinical parameters of patients was analyzed, and it was observed that high expression of WWP1 was associated with higher Gleason score and T stage in patients.

Table 4

Correlation between WWP1 expression in tumor tissues and clinical characteristics of PCa patients

Clinical characteristics		n=38	WWP1 IHC score		p-Value
			High (n=19)	Low (n=19)
Age (years)	≥66	17	11	6	0.1028
	<66	21	8	13
PSA (ng/mL)	≥9.67	13	7	6	0.7324
	<9.67	25	12	13
Gleason score	≤6	11	2	9	0.0037*
	3+4	10	3	7
	4+3	9	8	1
	≥8	8	6	2
AR status	Positive	30	15	15	>0.9999
	Negative	8	4	4
p53 status	Positive	15	8	7	0.7400
	Negative	23	11	12
T stage	pT2	23	7	16	0.0076*
	pT3	13	11	2
	pT4	2	1	1
Lymph node metastasis	Absent	27	14	13	0.7206
	Present	11	5	6

Open in a separate window

Chi-square test was used to analyze the correlation between gene expression in PCa tumor tissues and clinical characteristics of patients. PCa: prostate cancer; PSA: prostate-specific antigen; AR: androgen receptor; IHC: immunohistochemistry; *p<0.05

MYC is involved in the regulatory role of FAM84B on WWP1

To investigate the molecular mechanism of FAM84B-mediated WWP1, we first analyzed the function of FAM84B. The UCSC Genome Browser (https://genome.ucsc.edu/) is a web-based tool serving as a multipowered microscope that allows researchers to view all 23 chromosomes of the human genome at any scale from a full chromosome down to an individual nucleotide. As predicted by the UCSC Genome Browser, FAM84B was localized to the 8q24.21 gene desert (Fig. S2A). FAM84B has been suggested to contribute to the oncogenic effect of MYC, and the FAM84B and MYC genes border a 1.2 Mb gene desert at 8q24.21 [11]. By GEPIA, we also verified the positive correlation between MYC and FAM84B or WWP1 in PCa (Fig S2B, C). The Cistrome Data Browser (http://cistrome.org/db/#/) is a resource of ChIP-seq, ATAC-seq, and DNase-seq data from humans and mice and provides maps of the genome-wide locations of transcription factors, cofactors, chromatin remodelers, histone posttranslational modifications, and regions of chromatin accessible to endonuclease activity. We observed a significant binding of MYC to the WWP1 promoter in LNCaP cells from the ChIP-seq database in the Cistrome Data Browser (Fig. S2D). We therefore hypothesized that FAM84B-mediated MYC activates WWP1 transcription.

MYC was highly expressed in PCa tissues (Fig. 4A) and was significantly and positively correlated with FAM84B and WWP1 expression (Fig. 4B). PCa patients were divided into two cohorts of high MYC expression (n=19) and low MYC expression (n=19) based on the mean MYC IHC scores in tumor tissues. Higher expression of MYC in tumor tissues was associated with higher Gleason score, p53 status, and lymph node metastasis in patients (Table 5). The prognostic significance of MYC on patients’ clinical characteristics differed from that of FAM84B and WWP1, which we hypothesized to be related to the small number of our clinical samples (n=38).

Open in a separate window

Fig. 4

FAM84B-mediated MYC activates the transcription of WWP1. A MYC protein expression in PCa and adjacent tissues (n=38) was examined using IHC. B The correlation of MYC expression and FAM84B/WWP1 expression in PCa tissues was analyzed using Pearson’s correlation analysis (n=38). C The FAM84B, MYC, and WWP1 protein expression in PCa cells in response to overexpression of FAM84B and MYC inhibitor MYCi361 treatment was examined using western blot assays. D The binding ability of MYC in the WWP1 promoter region in PCa cells in response to overexpression of FAM84B and MYC inhibitor MYCi361 treatment was examined using western blot assays. E The transcription of WWP1 promoter in PCa cells in response to overexpression of FAM84B and MYC inhibitor MYCi361 treatment was analyzed using dual-luciferase assays. Experiments were repeated three times with multiple wells. The bars indicate SD. *p<0.05 (paired t-test, two-way ANOVA)

Table 5

Correlation of MYC expression in tumor tissues with clinical parameters of PCa patients

Clinical characteristics		n=38	MYC IHC score		p-Value
			High (n=19)	Low (n=19)
Age (years)	≥66	17	8	9	0.7442
	<66	21	11	10
PSA (ng/mL)	≥9.67	13	6	7	0.7324
	<9.67	25	13	12
Gleason score	≤6	11	1	10	0.0012*
	3+4	10	6	4
	4+3	9	4	5
	≥8	8	8	0
AR status	Positive	30	13	17	0.1115
	Negative	8	6	2
p53 status	Positive	15	11	4	0.0202*
	Negative	23	8	15
T stage	pT2	23	10	13	0.2911
	pT3	13	7	6
	pT4	2	2	0
Lymph node metastasis	Absent	27	10	17	0.0123*
	Present	11	9	2

Open in a separate window

Chi-square test was used to analyze the correlation between gene expression in PCa tumor tissues and clinical characteristics of patients. PCa: prostate cancer; PSA: prostate-specific antigen; AR: androgen receptor; IHC: immunohistochemistry; *p<0.05

PCa cell lines stably overexpressing FAM84B were constructed and treated with the MYC inhibitor MYCi361 in combination. It was found using Western blot that FAM84B overexpression significantly increased the expression of MYC and WWP1, while MYCi361 significantly reversed the effect of FAM84B (Fig. 4C). Chromatin immunoprecipitation quantitative PCR (ChIP-qPCR) experiments showed that overexpression of FAM84B resulted in increased MYC enrichment on the WWP1 promoter, while MYC enrichment to the WWP1 promoter fragment was significantly reduced after MYCi361 treatment (Fig. 4D). Finally, overexpression of FAM84B promoted the transcription of the WWP1 promoter, as demonstrated by promoter luciferase reporter assays, while simultaneous treatment with MYCi361 significantly inhibited the transcription of the WWP1 promoter (Fig. 4E).

The exact mechanism by which FAM84B mediates MYC activation remains unclear. Distal enhancer on 8q24 mediates MYC transcription through beta catenin/TCF4 signaling [17], and silencing of FAM84B markedly reduced the level of active beta catenin and the transcription activity of TCF/LEF in glioma [18]. We therefore hypothesized that MYC expression in FAM84B-activated PCa might be beta catenin-dependent. PCa cells overexpressing FAM84B were treated with the classical Wnt signaling pathway inhibitor LF3 to disrupt the interaction between beta catenin and TCF4. Western blot detected that overexpression of FAM84B enhanced the protein expression of beta catenin in PCa cells, whereas LF3 did not affect the protein expression of beta catenin (Fig. S3A). The TOP/FOP flash assay confirmed that overexpression of FAM84B enhanced beta catenin signaling in PCa cells and LF3 significantly blocked beta catenin signaling (Fig. S3B). RT–qPCR showed that overexpression of FAM84B promoted the transcriptional expression of MYC, and blocking beta catenin signaling using LF3 reduced MYC transcription (Fig. S3C). ChIP–qPCR experiments detected that overexpression of FAM84B promoted the enrichment of beta catenin at the MYC promoter, while LF3 treatment inhibited beta catenin binding to the MYC promoter (Fig. S3D). The results of the MYC promoter luciferase reporter assay demonstrated that FAM84B promoted MYC promoter transcriptional activity in a beta catenin-dependent manner (Fig. S3E).

MYC shows the tumor-promoting and metastasis-promoting properties in PCa in a WWP1-dependent manner

MYC inhibitor MYCi361 was used to treat PCa cell lines with or without oeWWP1. RT–qPCR detected that MYCi361 repressed the transcription of endogenous WWP1, but oeWWP1-mediated exogenous WWP1 overexpression significantly reversed the effect of MYCi361 on WWP1 expression (Fig. 5A). This again validates that MYC activates WWP1 transcription by binding to the WWP1 promoter, as MYCi361 is unable to block WWP1 transcription mediated by an exogenous overexpressing lentivirus using the strong promoter (EF1A).

Open in a separate window

Fig. 5

MYC promotes WWP1 expression to drive PCa tumor progression. PCa cells were treated with DMSO, MYCi361, oeCtrl+MYCi361, and oeWWP1+MYCi361 (A) WWP1 mRNA expression in PCa cells was examined using RT–qPCR. B, C The PCa cell proliferation and DNA synthesis activity were assessed using CCK8 and EdU staining. D The growth rate of xenograft tumors formed by subcutaneously inoculated PC-3 cells in mice treated with MYCi361 or DMSO (n=5). E MYC, WWP1, and Ki67 protein expression in xenograft tumors (n=5) was examined using IHC. F, G The migratory and invasive capacity of PCa cells were examined using transwell assays. H Observation of tumor cell metastasis formed by intracardiac injection of PC-3 cells in mice treated with MYCi361 or DMSO by bioluminescence imaging (n=5). Experiments were repeated three times with multiple wells. The bars indicate SD. *p<0.05 (one-way/two-way ANOVA). Scale bar=50 μm

MYCi361 treatment significantly inhibited the proliferation of PCa cells and suppressed DNA synthesis, while the overexpression of WWP1 rescued PCa cell growth in vitro (Fig. 5B, ​B,C).C). In in vivo experiments, tumor growth inhibition by MYCi361 administration was also observed, but the inhibitory effect of MYCi361 on the growth of tumor cells was significantly attenuated following WWP1 overexpression (Fig. 5D). IHC detected that MYCi361-mediated MYC inhibition reduced the expression of WWP1 and Ki67 in xenograft tumors. However, Ki67 expression was enhanced in tumor tissues stably overexpressing WWP1 (Fig. 5E).

MYCi361 treatment inhibited the migratory and invasive properties of PCa cells (Fig. 5F, ​F,G)G) and reduced the metastatic dissemination in vivo (Fig. 5H). In contrast, the inhibitory effect of MYCi361 on the metastatic activity of PCa cells was significantly reversed by oeWWP1 (Fig. 5F–H).

WWP1 mediates the degradation of CDKN1B

UbiBrowser 2.0 (http://ubibrowser.bio-it.cn/ubibrowser_v3/) is a comprehensive resource for proteome-wide known and predicted ubiquitin ligase (E3)/deubiquitinase–substrate interactions in eukaryotic species. For the analysis of the WWP1-mediated cancer promotion mechanism, we first predicted the downstream proteins of WWP1 (Fig. 6A) in UbiBrowser 2.0. The STRING database (https://string-db.org/) systematically collects and integrates protein–protein interactions (PPI) under physical and functional associations. The PPI network of WWP1 targets was constructed using STRING (Fig. 6B). In the network, there are known tumor suppressors in PCa, such as CDKN1B [19], TP53 [20], and PTEN [21]. Considering that WWP1 exhibited oncogenic effects in PC-3 cells [22] that do not express TP53 (p53 null), TP53 is not a major target of action of WWP1. Meanwhile, CDKN1B has been reported to inhibit MYC expression in PCa [23]. This suggests that MYC mediates the transcription of WWP1 and may mitigate the repressive effect of CDKN1B on MYC expression by degrading CDKN1B through ubiquitination.

Open in a separate window

Fig. 6

Downstream target analysis of WWP1. A Predicted downstream target proteins of E3 ubiquitin ligase WWP1. B PPI network of WWP1 target proteins. C CDKN1B protein expression in PCa tissues and adjacent tissues (n=38) was examined using IHC. D The correlation of CDKN1B expression and FAM84B/WWP1/MYC expression in PCa tissues was analyzed using Pearson’s correlation analysis (n=38). E The CDKN1B protein expression in PCa cells in response to overexpression of WWP1 and MYC inhibitor MYCi361 treatment was examined using western blot assays. F The CDKN1B mRNA expression in PCa cells in response to overexpression of WWP1 and MYC inhibitor MYCi361 treatment was examined using RT–qPCR. G Endogenous interaction between CDKN1B and WWP1 in PCa cells and the effect of overexpression of WWP1 on ubiquitination of CDKN1B protein examined using Co-IP. H The effect of overexpression of WWP1 on the stability of CDKN1B protein in PCa cells treated with CHX. Experiments were repeated three times with multiple wells. The bars indicate SD. *p<0.05 (one-way/two-way ANOVA)

CDKN1B expression was significantly reduced in PCa tissues (Fig. 6C), and CDKN1B expression was significantly negatively correlated with FAM84B, MYC, and WWP1 (Fig. 6D). PCa patients were divided into two cohorts: CDKN1B high expression (n=20) and CDKN1B low expression (n=18), based on the mean CDKN1B IHC scores in tumor tissues. Low expression of CDKN1B in tumor tissues was associated with higher Gleason score, T stage, and lymph node metastasis in patients (Table 6).

Table 6

Correlation between CDKN1B expression in tumor tissues and clinical parameters of PCa patients

Clinical characteristics		n=38		CDKN1B IHC score		p-value
				High (n=20)	Low (n=18)
Age (years)	≥66	17		8	9	0.5359
	<66	21		12	9
PSA (ng/mL)	≥9.67	13		7	6	0.9139
	<9.67	25		13	12
Gleason score	≤6	11		11	0	0.0007*
	3+4	10		7	3
	4+3	9		2	7
	≥8	8		0	8
AR status	Positive	30		16	14	0.8668
	Negative	8		4	4
p53 status	Positive	15		7	8	0.552
	Negative	23		13	10
T stage	pT2	23		17	6	0.0042*
	pT3	13		3	10
	pT4	2		0	2
Lymph node metastasis	Absent		27	17	10	0.0457*
	Present		11	3	8

Open in a separate window

Chi-square test was used to analyze the correlation between gene expression in PCa tumor tissues and clinical characteristics of patients. PCa: prostate cancer; PSA: prostate-specific antigen; AR: androgen receptor; IHC: immunohistochemistry; *p<0.05

MYCi361 treatment promoted CDKN1B protein expression, while exogenous overexpression of WWP1 diminished CDKN1B protein expression (Fig. 6E). Neither MYCi361 treatment nor exogenous overexpression of WWP affected the mRNA expression of CDKN1B (Fig. 6F). Co-IP experiments observed an interaction between endogenous WWP1 and CDKN1B protein and observed an increase in the ubiquitination level of CDKN1B protein caused by overexpression of WWP1 (Fig. 6G). Overexpression of WWP1 led to a significant decline in the stability of CDKN1B protein and a higher rate of protein degradation (Fig. 6H).

None.