2.2. Structural properties of monomeric LDH‐A

Having observed that β‐NADH and oxamate are able to promote the tetramerization of LDH‐A monomers, we considered of interest to characterize, by Dynamic Light Scattering (DLS), the association of the enzyme subunits. First, we analyzed the distribution of particles using monomeric LDH‐A in 10mM Tris–HCl, pH7.5. Notably, when three consecutive DLS assays were carried out with this sample the observed peaks were indicative of a considerable polydispersity of the detected particles (Figure 3a). Moreover, the size distribution of LDH‐A particles revealed quite important differences among the three assays, suggesting a considerable spreading over a wide conformational landscape (Figure 3a). In contrast, the addition of 125μM β‐NADH to monomeric LDH‐A was found to translate into a monodisperse sample (Figure 3b). Furthermore, no major differences were observed among the outputs generated by three successive DLS assays (Figure 3b). In particular, under these conditions the molecular mass of LDH‐A was determined as equal to 212±35, 212±31, and 190±27kDa, respectively, yielding a mean value equal to 205±13kDa. Remarkably, when both 125μM β‐NADH and 10mM oxamate were added to monomeric LDH‐A, the DLS peaks observed with three consecutive analyses featured high reciprocal similarity, and are indicative of a monodisperse sample (Figure 3c). Under these conditions, the values of molecular mass of LDH‐A were determined as equal to 153±9, 153±14, and 138±16kDa, respectively, yielding a mean value of 148±9kDa, in excellent agreement with an expected value for tetrameric LDH‐A equal to 146.3kDa.

Open in a separate window

FIGURE 3

Analysis of the quaternary and secondary structure of human LDH‐A. (a–c) Dynamic light scattering experiments performed with monomeric LDH‐A in: (a) 10mM Tris–HCl, (b) 10mM Tris–HCl supplemented with 125μM β‐NADH, (c) 10mM Tris–HCl containing 125μM β‐NADH and 10mM oxamate. All buffers were poised at pH7.5. (d) Far‐UV CD spectra of tetrameric and monomeric LDH‐A (green and blue line, respectively), in PBS buffer.

To inspect the secondary structure of monomeric LDH‐A, we compared its circular dichroism (CD) spectrum with that of the tetrameric enzyme. It should be noted that both spectra were obtained in PBS buffer, containing 137mM NaCl. Therefore, the ionic strength of the buffer should induce the association of LDH‐A monomers into the corresponding tetramer (cf. Figure 1d,e). Interestingly, no major differences were detected between the two samples, with the only exception being the amplitude of molar ellipticity at 208nm (Figure 3d).

2.3. Binding of β‐NADH by tetrameric and monomeric LDH‐A

To further inspect the biochemical features of monomeric LDH‐A, we analyzed the binding of β‐NADH to LDH‐A (at pH7.5) by Surface Plasmon Resonance (SPR). First, we tested the association between the tetrameric enzyme and the redox cofactor. Unfortunately, both the binding of β‐NADH to tetrameric LDH‐A and the subsequent dissociation of the binary complex were found to obey a very fast kinetics, whose rate constants could not be determined (Figure 4a). Nevertheless, our observations were useful to determine the K _D of the enzyme–cofactor complex, the value of which was evaluated by means of three independent assays as equal to 28, 22, and 21μM, yielding a mean value equal to (23±4)•10⁻⁶M (Figure 4b). Surprisingly, when the binding of β‐NADH to monomeric LDH‐A was tested, the association of the redox cofactor to the monomeric enzyme featured a much lower amplitude than that detected in the presence of tetrameric hLDH‐A (Figure S4, cf. with Figure 4a). However, by decreasing to 7.0 the pH of the binding assay, the observed amplitude was more than twice the corresponding response at pH7.5 (Figure S4). Moreover, a further assay performed at pH7.0 (i.e., under the more favorable condition) revealed a linear dependence of the SPR response up to very high β‐NADH concentrations, for example, 10mM (Figure 4c,d). Accordingly, the K _D for the monomer‐coenzyme binary complex cannot be determined, with this finding being apparently in contrast with the observations obtained by means of DLS experiments (Figure 3). However, it should be considered that the DLS experiments were carried out with free LDH‐A monomers, whereas the SPR assays were performed with immobilized enzyme which therefore is incapable to assemble into the tetrameric form. Accordingly, we propose that the binding of β‐NADH and the assembly of monomers represent a concerted action, the occurrence of which is hampered by the immobilization of LDH‐A.

Open in a separate window

FIGURE 4

Binding of β‐NADH to tetrameric and monomeric hLDH‐A. (a) Kinetics of the association of β‐NADH to tetrameric hLDH‐A as detected by surface plasmon resonance. Sensorgrams were observed loading increasing concentration of β‐NADH (0.49–125μM) on a sensor chip modified with immobilized tetrameric human LDH‐A. (b) Determination of the K _D of hLDH‐A for β‐NADH. The response units refer to the data shown in “a.” The continuous lines represent the best fit of a parametric rectangular hyperbola to the experimental observations. (c) Sensorgrams observed loading increasing concentration of β‐NADH (0.25–10mM) on a sensor chip modified with immobilized monomeric human LDH‐A. (d) Linear dependence of the response units reported in “c” on the concentration of loaded β‐NADH. The continuous line represents the best fit of a linear equation to the experimental observations.

2.4. Kinetics of pyruvate reduction by tetrameric and monomeric LDH‐A

As previously mentioned, DLS assays revealed that the addition of β‐NADH and oxamate to monomeric LDH‐A triggers the assembly of LDH‐A monomers into the enzyme tetrameric form. Accordingly, the assembled monomers should feature catalytic competence, the extent of which would be, in turn, suggestive of monomers‐to‐tetramer conversion. Therefore, we performed a set of activity assays using reaction mixtures containing 10mM Tris–HCl (pH7.5), 100μM β‐NADH, 500μM pyruvate, and variable concentrations of LDH‐A in monomeric or tetrameric form. To prime this analysis, we compared the kinetics of β‐NADH oxidation catalyzed by tetrameric or monomeric LDH‐A, at 7.6nM final concentration of subunits. When the tetrameric enzyme was used, we detected a very fast reaction, reaching equilibrium in about 2.5min (Figure 5a). Conversely, when monomeric LDH‐A was used, the reaction rate was definitely slower, taking approximately 20min to approach completion (Figure 5a). We propose that this sharp difference represents the outcome of two major factors: (i) a partial assembly of monomers into the enzyme homotetramer and (ii) during the reaction the limiting substrate (β‐NADH) is oxidized, therefore restraining the assembly of monomers. Taking into account that tetrameric LDH‐A faces a dilution‐induced dissociation, even under conditions of neutral pH (Pasti et al., ²⁰²²), further tests were carried out in the presence of much lower concentrations of enzyme. We indeed reasoned that in the presence of low enzyme concentrations the difference between the activities exerted by tetrameric LDH‐A and by assembled monomers should be less pronounced when compared to the difference observed at higher enzyme concentrations. Therefore, LDH‐A activity was assayed in the presence of concentrations of LDH‐A subunits ranging from 0.0125 to 0.2nM. As expected, tetrameric LDH‐A outperformed the catalytic action of assembled monomers (Figure 5b,c), albeit to a lower extent compared to the difference observed in the presence of 7.6nM enzyme (Figure 5a). Quantitatively speaking, by fitting a single exponential equation to the experimental observations larger k _obs values were determined for the LDH‐A tetramer, except under the conditions of maximal dilution (0.0125 and 0.025nM subunits, Figure 5d).

Open in a separate window

FIGURE 5

Kinetics of β‐NADH oxidation catalyzed by tetrameric or monomeric human LDH‐A. (a–c) Activity assays were performed using reaction mixtures containing 50mM Tris–HCl (pH7.5), 100μM β‐NADH, and 500μM pyruvate. (a) Kinetics of β‐NADH oxidation detected in the presence of 7.6nM of tetrameric or monomeric LDH‐A (green and blue line, respectively). (b, c) Time‐course of β‐NADH oxidation catalyzed by 12.5, 25, 50, 100, or 200 pM tetrameric (b) or monomeric (c) human LDH‐A (magenta, cyan, red, blue, and green circles, respectively). The time‐course observed in the absence of enzyme is also reported (white circles). (d) Dependence on enzyme concentration of the rate constants determined for the reactions catalyzed by tetrameric (white circles) or monomeric LDH‐A (black circles) and reported in “b” and “c.” To obtain the k _obs values a single‐exponential equation was fitted to the experimental observations.

2.5. Kinetic parameters of tetrameric and monomeric LDH‐A

To further characterize the catalytic action of monomeric LDH‐A exposed to β‐NADH and pyruvate, and therefore assembled into tetramer (cf. Figure 3c), we determined the enzyme activity as a function of pyruvate or β‐NADH concentration. In addition, the kinetics of pyruvate reduction catalyzed by tetrameric LDH‐A was assayed under the same conditions used for the monomeric enzyme. Structurally and functionally speaking, the availability of monomeric LDH‐A does indeed provide an unprecedented and quite interesting tool to perform quantitative tests of the assembly of monomers into the corresponding catalytically active tetramer. When reaction velocity was observed as a function of pyruvate concentration in the presence of 125μM β‐NADH, tetrameric LDH‐A outperformed its monomeric counterpart, featuring a lower K _m and a higher k _cat, that is, 271±40 versus 561±74μM and 66±5 versus 32±3s⁻¹ (Figure 6a,c). In addition to this, the enzyme kinetic parameters were also determined testing reaction velocity as a function of β‐NADH concentration, in the presence of 500μM pyruvate. Under these conditions, tetrameric LDH‐A was again observed to outperform the assembled monomers, essentially featuring the same K _m for the redox cofactor (9.0±0.6 and 7.7±1.1μM, for tetramer and assembled monomers, respectively) and a three‐fold higher k _cat, that is, 90±2 and 29±1s⁻¹, respectively (Figure 6b,c).

Open in a separate window

FIGURE 6

Catalytic action of tetrameric and monomeric human LDH‐A. (a) Dependence of the initial velocity of β‐NADH oxidation observed as a function of pyruvate concentration, in the presence of 125μM β‐NADH and 2.6nM tetrameric (white circles) or 9.8nM monomeric (black circles) human LDH‐A. The continuous lines represent the best fit of the Michaelis–Menten equation to the experimental observations. (b) Dependence of the initial velocity of β‐NADH oxidation observed as a function of β‐NADH concentration, in the presence of 500μM pyruvate and 1.9nM tetrameric (white circles) or 7.6nM monomeric (black circles) human LDH‐A. The continuous lines represent the best fit of the Michaelis–Menten equation to the experimental observations. (c) Kinetic parameters determined by performing activity assays using monomeric or tetrameric LDH‐A, at the indicated final concentrations. Under conditions of variable pyruvate concentration, β‐NADH was always used at 125μM. When reaction mixtures contained variable concentrations of the redox cofactor, pyruvate was invariably added at 500μM. All the assays were performed at pH7.5 (Tris‐BisTris, 10mM each).

The divergence between the kinetic parameters determined for monomeric and tetrameric LDH‐A should be interpreted in terms of the monomers‐to‐tetramer assembly. In particular, when the k _cat values are considered, the ratio of their values suggests that approximately one half to one third of monomers generates tetramer, in the presence of excess pyruvate and β‐NADH, respectively. Moreover, it is interesting to note that the K _m of assembled monomers for pyruvate is about twice the value determined for tetrameric LDH‐A. This observation suggests that pyruvate is capable to stabilize tetrameric LDH‐A by binding to a secondary site, featuring low affinity for the monocarboxylic acid.

2.6. Design of peptides directed against LDH‐A subunit–subunit interactions

The inspection of two quaternary structures available for LDH‐5 (PDB files 1I10 and 4OJN: Read et al., ²⁰⁰¹; Kolappan et al., ²⁰¹⁵) led us to identify the N‐terminal region of LDH‐A as the target for inhibiting the assembly of the enzyme tetrameric form. In particular, since LDH‐5 can be considered as a binary association of dimers, we focused on the interactions between the residues 10–20 of the N‐terminal region of one monomer, and the residues 296–303 near the C‐terminus of the second monomer (Figure 7a). Accordingly, we designed the linear octapeptide TH1 as a potential inhibitor of LDH‐A oligomerization, featuring the primary structure GQNGISDL, the sequence of which is identical to the stretch of residues 296–303 of the target protein. To correlate the coordinates of peptides with those of LDH‐5 as denoted in the PDB files (shifted to a−1 position due to the lack of the methionine coded by the start codon) the positions of the amino acids in the peptides are hereafter accordingly indicated (e.g., the residues 296–303 translate into 295–302). Interestingly, it can be recognized that the stretch of amino acids 295–302 does clearly feature two turns, centered on the tetrapeptides G²⁹⁵QNG²⁹⁸, and I²⁹⁹SDL³⁰², respectively (Figure 7b). To design cyclic peptides inspired by these turns, we performed molecular modeling simulations. Plausible 3D structures of candidate turn mimetics were estimated by simulated annealing and molecular dynamics (MD) simulations, using the AMBER force field in explicit water (Cornell et al., ¹⁹⁹⁵). In brief, random geometries of each cyclopeptide were sampled during a high temperature unrestrained MD simulation in a box of TIP3P models of equilibrated water molecules (Jorgensen et al., ¹⁹⁸³). Each random structure was slowly cooled, the resulting structures were minimized, and the backbones of the structures were clustered by rmsd analysis. Only candidates showing one major cluster comprising the large majority of the geometries were considered. From this cluster the representative structures with the lowest energy were then selected and their conformations compared to those of the G²⁹⁵QNG²⁹⁸ (Figure 7c) and I²⁹⁹SDL³⁰² (Figure 7f) turns. This procedure resulted in the in silico selection of two mimetics of G²⁹⁵QNG²⁹⁸ (Figure 7c), that is, the cyclopeptides c[GQN‐isoD] (TH2, Figure 7d) and [GQN‐(R)‐isoD] (TH3, Figure 7e), in which either (S)‐ or (R)‐Asp is framed within a 13‐membered ring as a β‐amino acid (isoAsp). The structures calculated for the 13‐membered cyclotetrapeptides are not unexpected. Indeed, β‐amino acids are well known to stabilize defined secondary structures, in particular γ‐turns or pseudo‐γ‐turns (Glenn et al., ²⁰⁰³).

Open in a separate window

FIGURE 7

Design of the peptides to be tested against monomeric LDH‐A. (a) Details of the interactions between the N‐terminal region of one monomer with the residues 295–302 located at the C‐terminus of a second monomer, and (b) stick representation of the same region. Structural details of: (c) the G²⁹⁵QNG²⁹⁸ turn, and (d) the 13‐membered cyclopeptides c[GQN‐isoD] (TH2) and (e) c[GQN‐(R)‐isoD] (TH3), (f) the I²⁹⁹SDL³⁰² turn, and the cyclopeptides (g) c[isoKSDL] (TH4) and (h) c[isoKSD‐(R)‐L] (TH5).

In addition, by means of this strategy two mimetics of I²⁹⁹SDL³⁰² were selected (Figure 7f), namely the cyclopeptides c[isoKSDL] (TH4, Figure 7g) and c[isoKSD‐(R)‐L] (TH5, Figure 7h), in which (S)‐ or (R)‐Lys is involved in the macrolactamization by the side‐chain amino group (isoLys). The chemical sketches of the cyclopeptides and of the majority of the intermediates are reported in Table 1. These cyclopeptides were prepared by cyclization of linear precursors, obtained in turn by solid phase peptide synthesis. To this aim, the tetrapeptide GQNG was modified into the partially protected GQND‐OBn (TH6) or GQN‐(R)‐d‐OBn (TH7), while ISDL was modified into Fmoc‐KSD(OBn)L (TH8) or Fmoc‐KSD(OBn)‐(R)‐L (TH9). These linear sequences were synthesized using standard procedures on a Wang resin using Fmoc‐protected amino acids, and DCC/HOBT as activating agents (Table S1). (S)‐ or (R)‐Asp was introduced as Fmoc‐Asp(OBn)OH, or Fmoc‐Asp(OBn); Lys was introduced as Fmoc‐Lys(Boc)OH. Fmoc deprotection was carried out using 20% (v/v) piperidine in DMF. Cleavage from the resin and simultaneous removal of the acid‐labile protecting groups was performed by using TFA in the presence of scavengers.

TABLE 1

Structural and functional features of the linear and cyclic peptides assayed as candidate inhibitors of LDH‐A activity.

Peptide	Structure	Sequence	Inhibition (%)
TH1		GQNGISDL	36±1
TH2		c[GQN‐isoD]	31±3
TH3		c[GQN‐iso(R)D]	26±1
TH4		c[isoKSDL]	16±3
TH5		c[isoKSDL]	7±3
TH6		GQND‐OBn	14±7
TH7		GQN‐(R)D‐OBn	4±2
TH10		c[GQN‐isoD(OBn)]	6±3
TH11		c[GQN‐(R)isoD‐(OBn)]	8±4
TH14		GQND(OBn)	15±4
TH15		c[GQND(OBn)]	9±2
TH16		GQND	22±2
TH17		GQN‐(R)D	4±8
TH18		KSDL	5±6
TH19		KSD‐(R)L	4±3
DS105		NQGD	0

Open in a separate window

Note: The SD (n=3) associated with each estimated value of inhibition is indicated.

The cyclization of the partially protected linear peptides was performed under pseudo‐high dilution conditions, by slowly adding the peptide to a mixture of NaHCO₃ and DPPA in DMF. The crude cyclopeptides c[GQN‐isoD(OBn)](TH10), c[GQN‐(R)‐isoD(OBn)] (TH11), c[isoK(Fmoc)‐SD(OBn)L] (TH12), c[isoK(Fmoc)‐SD(OBn)‐(R)‐L] (TH13), were isolated by RP HPLC on a semipreparative C18 column (Table S1). Removal of benzyl protecting groups was performed in quantitative yield by catalytic hydrogenation, giving c[GQN‐isoD] (TH2), c[GQN‐(R)‐isoD] (TH3), while Fmoc deprotection was done as described above, affording c[isoKSDL] (TH4), c[isoKSD‐(R)‐L] (TH5). The purities of the final products were determined to be >95% by RP HPLC (Table S1), and their identity was confirmed by ESI‐MS, ¹H and ¹³C NMR, and by 2D gCOSY experiments at 600MHz in DMSO‐d ₆ .

We also prepared and tested the partially protected linear peptides GQND(OBn) (TH14), whose cyclization provided the 12‐membered c[GQND(OBn)] (TH15). Furthermore, starting from the partially protected linear peptides described above, we prepared and assayed the fully deprotected linear sequences GQND (TH16), GQN‐(R)‐D (TH17), KSDL (TH18), and KSD‐(R)‐L (TH19) (Tables 1, and S2).

2.7. Peptides and inhibition of LDH‐A activity

As previously mentioned, monomeric LDH‐A assembles into the corresponding tetramer when exposed to β‐NADH and pyruvate (or β‐NADH and oxamate, see Figure 1c), therefore gaining dehydrogenase activity. Accordingly, to test the action of peptides against the assembly of tetrameric LDH‐A, we performed activity assays under steady‐state conditions, in the presence of monomeric enzyme, 125μM β‐NADH and 0.5mM pyruvate. In particular, all the peptides were tested at 80μM (final concentration), and the LDH activity detected in their presence was compared with the catalytic action observed with control samples devoid of any peptide. First, we decided to assay the octameric peptide TH1, the primary structure of which (GQNGISDL) is identical to the LDH‐A region spanning residues 295–302. Remarkably, the presence of this octapeptide was found to decrease the observed LDH activity by 36% (Figure 8a and Table 1). Moreover, it is important to note that when the TH1 octapeptide was tested against tetrameric LDH‐A no significant inhibition of the enzyme activity was observed. Indeed, the catalytic action exerted by 6nM tetrameric LDH‐A (in 10mM Tris–HCl, pH7.5, containing 150mM NaCl) was determined as equal to 433±11 and 452±19nM/s in the absence and in the presence of 80μM TH1 octapeptide, respectively. Overall, this insensitivity along with the significant effect elicited by TH1 on monomeric LDH‐A indicate that the octapeptide inhibits the assembly of LDH‐A monomers into the corresponding, catalytically active, tetramer. To dissect the inhibition triggered by TH1 on monomeric LDH‐A, we decided to evaluate: (i) whether or not the two halves of the octapeptide, that is, GQNG and ISDL, are equally competent in inhibiting LDH‐A; (ii) the action of linear and cyclic peptides, containing or not D amino acids; and (iii) the effect, if any, triggered by the presence of protecting groups in the peptides to be assayed. The structures and the distinctive features of all peptides considered are reported in Table 1. It should be noted that to allow the cyclization of tetrapeptide GQNG while maintaining a terminal carboxylic group, the sequence was modified to GQND, while for the cyclization of ISDL while maintaining a terminal amino group, the sequence was modified into KSDL (Table 1).

Open in a separate window

FIGURE 8

Inhibition exerted by linear and cyclic peptides on LDH‐A activity detected in vitro. Activity assays were performed with reaction mixtures containing 6.2nM monomeric LDH‐A, 125μM β‐NADH, and 500μM pyruvate in Tris‐BisTris (10mM each) buffer, pH7.5 (white bar in “a”). The gray bars (in “a” and “d”) represent the activity observed in the presence of the same volume of DMSO (1%, v/v) carried to the assay mixtures by the peptides to be tested. (a–c) The effect, if any, of tetrameric peptides featuring the GQND primary structure (see also Table 1) on LDH‐A activity is shown. The inhibition exerted by the octameric peptide TH1 is also reported in “a.” The enzyme activity observed in the presence of linear or cyclic peptides is shown in “b” and “c”, respectively. (d) Extent of LDH‐A activity detected in the presence of linear or cyclic tetrapeptides featuring the KSDL primary structure. Error bars represent SD (n=3). The experimental observations were compared by Student's t‐test. The ***, **, and * symbols denote p values lower than 0.001, 0.01, and 0.02, respectively. (e) Simulation of the association between the TH2 peptide and monomeric LDH‐A. Predicted interactions between the cyclopeptide c[GQN‐isoD] (TH2) and the N‐terminal sequence Y⁹NLLKEEQTPQ¹⁹, as simulated by molecular dynamics in a box of explicit TIP3P water molecules; gray and red dotted lines represent hydrogen bonds and salt bridges, respectively.

Remarkably, the GQND linear tetrapeptide TH16 was found to be a quite effective inhibitor, being responsible for a 22% decrease of LDH‐A activity (Figure 8a and Table 1). In addition, to obtain a scrambled variant of TH16 presumably devoid of inhibitory action, we constructed DS105, a linear tetrapeptide featuring the NQGD primary structure. As expected, the catalytic action of LDH‐A is insensitive to the presence of DS105 in the assay mixture (data not shown). Furthermore, we did not detect a significant inhibition of LDH‐A in the presence of TH17, which differs from TH16 for the specific substitution of l‐aspartate with d‐aspartate (Table 1 and Figure 8b). Therefore, the replacement of a single l‐amino acid with its d‐counterpart does completely suppress the interference exerted by TH16 on the assembly of LDH‐A monomers into the corresponding catalytically active tetramer. The effect, if any, of the presence of a protecting benzyl group in the GQND tetrapeptide was then analyzed. In particular, the inhibitory action of different protected peptides was compared with the action of the TH16 peptide, and the following observations were accordingly obtained: (i) the TH14 peptide, bearing a benzyl group bound to the C′‐carboxyl (Table 1), performs less than its progenitor TH16 (Figure 8b); (ii) the TH6 peptide, featuring a benzyl group located at the Cβ‐carboxyl (Table 1), does weakly perform when compared to TH16, being responsible for 14% inhibition of LDH‐A activity (Figure 8b); (iii) the presence in TH7 of a benzyl group bound to the C′‐carboxyl (Table 1) does not confer a significant inhibitory action to this tetrapeptide, which therefore behaves as its inactive parental unprotected peptide TH17 (Figure 8b). Rather interestingly, when cyclic and unprotected GQND tetrapeptides were assayed, a similar extent of LDH‐A inhibition was observed with TH2 and TH3 (Table 1), containing l‐ and d‐aspartate, respectively (Figure 8c). In addition to this, we determined that cyclic GQND TH10, TH11, and TH15 tetrapeptides, bearing a benzyl protecting group, were outperformed by their unprotected counterparts (Figure 8c).

Overall, the KSDL tetrapeptides were found less effective than their GQND counterparts. In particular, the cyclic TH4 tetrapeptide was found to inhibit LDH‐A activity by 16% only (Figure 8d and Table 1), which is significantly lower than the level of inhibition exerted by TH2 (Figure 8c and Table 1).

2.8. Molecular modeling

According to our observations, among the cyclopeptides tested c[GQN‐isoD] (TH2) and [GQN‐(R)‐isoD] (TH3), feature the highest inhibitory efficiency (Figure 8c). Apparently, the cyclic structure contributes to improve their performances, possibly by imposing a proper 3D structure mimicking the G²⁹⁵QNG²⁹⁸ turn. Nevertheless, the presence of a free carboxylic group seems also quite important, as suggested by the very poor efficacy of the corresponding benzyl esters c[GQN‐isoD(OBn)] (TH10), and c[GQN‐(R)‐isoD(OBn)] (TH11). To ascertain any role played by the free carboxylic group in the inhibition of LDH‐A oligomerization, we predicted by molecular modeling and molecular dynamics the possible interactions between the cyclopeptide c[GQN‐isoD] (TH2) and the N‐terminal target sequence of the monomer (Figure 7a,b). The structures of the interacting N‐terminal residues 9 to 19 and the C‐terminal residues 295–302 were obtained from the quaternary structure reported by Read et al. (PDB file 1I10, Read et al., ²⁰⁰¹). To prime the analysis, the cyclopeptide TH2 was superimposed to the G²⁹⁵QNG²⁹⁸ turn, then the C‐terminal sequence was removed. The system accordingly obtained was subjected to molecular dynamics simulations at 298K in a box of explicit TIP3P equilibrated water molecules. During this period, the geometry of the N‐terminal 9–19 sequence was restrained by applying a force field to dihedral angles and distances, while the cyclopeptide was maintained unrestrained. This step was followed by a stage with a scaled force field, and finally by a phase of unrestrained dynamics. During the last step, the conformation of the N‐terminal sequence 9–19 slightly changed, allowing the formation of a salt bridge between the carboxylate of cyclopeptide TH2 and the protonated amino side chain of Lys¹³ of the target N‐terminal region (Figure 8e).

With all due caution, the simulations seem to point at this interaction as a main contributor of the comparatively higher inhibitory efficacy of the cyclopeptides.

5.2. Activity assays

The enzyme‐catalyzed reduction of pyruvate was assayed by determining the decrease in Absorbance at 340nm related to the oxidation of β‐NADH. The extinction coefficient of β‐NADH at 340nm was considered equal to 6.22•10³M⁻¹cm⁻¹ (Bernofsky & Wanda, ¹⁹⁸²). All the assays were performed at 25°C using a Cary 300 Bio spectrophotometer. To determine the K _m of monomeric or tetrameric LDH‐A for pyruvate, reaction mixtures contained 125μM β‐NADH in 50mM Tris–HCl (pH7.5). Conversely, to determine the K _m of monomeric or tetrameric LDH‐A for β‐NADH reaction mixtures contained 500μM pyruvate in 50mM Tris–HCl, pH7.5.

The inhibition exerted by peptides on LDH‐A activity was tested by incubating 6.2nM enzyme and 80μM peptide in 10mM Tris–HCl, 10mM BisTris (pH7.5) buffer for 5min, at the end of which the reaction was started by the addition of 125μM β‐NADH and 500μM pyruvate.

5.3. Dynamic light scattering

Dynamic light scattering experiments were performed with a Malvern Panalytical (Malvern, UK) Zetasizer Nano ZS system. All the measurements were recorded at 25°C using solutions previously filtered with 0.2μm filters, and containing 5μM enzyme in 10mM Tris–HCl, pH7.5. Scattering was evaluated at an angle of 173 degrees. Each individual observed value of enzyme diameter represents the average output of three groups of consecutive determinations. Raw data were analyzed with the Zetasizer software (Malvern Panalyticals), release 7.11.

5.4. Circular dichroism

CD spectra were recorded over the 200–250nm wavelength interval at a scan rate equal to 50nm/min, using a Jasco J‐810 spectropolarimeter and a 0.5cm path‐length cuvette. Protein samples were in PBS, and the band width was set to 1nm. Sixteen scans per sample were acquired and averaged.

5.5. Surface plasmon resonance

The binding of β‐NADH by monomeric and tetrameric hLDH‐A was assayed using a Biacore T200 instrument (Cytiva, Marlborough, MA). Both monomeric and tetrameric LDH‐A were immobilized on a Xantec CMD500 chip at a concentration of 30μg/ml in 10mM HEPES, pH7 using a standard amine coupling protocol, yielding an observed immobilization level of 6984 and 17,424 response units (Rus), respectively. The binding of β‐NADH to hLDH‐A was tested in 50mM HEPES, pH7.5, at 25°C, using a flow rate of 50μl/min, with 60 and 10s of association and dissociation time, respectively. Different ranges of β‐NADH concentration were used, as indicated in the figures. The elaboration of sensorgrams was achieved using the BIAevaluation software.

5.6. Mass spectrometry

To verify the identity of monomeric LDH‐A, spots were excised from SDS‐PAGE gels and underwent trypsin‐in‐gel digestion as previously reported (Schevchenko et al., ²⁰⁰⁷). The resulting peptides were analyzed by LC–MS/MS using a Q‐Exactive instrument (Thermo‐Fisher Scientific, Waltham, MA) equipped with a nano‐ESI source coupled with an Ultimate capillary UHPLC as reported elsewhere (Conte et al., ²⁰¹²).

5.7. Cell cultures and determination of lactate dehydrogenase expression

To evaluate the competence of peptides in inhibiting the action of LDH‐A in cultured cells, two human cell cultures were used: MCF7 and BxPC3, isolated from breast and pancreatic adenocarcinoma, respectively. Cultures were grown in DMEM (MCF7) or RPMI medium (BxPC3), supplemented with 100U/ml penicillin/streptomycin, 2mM glutamine and 10% (v/v) FBS. All the components of the media used for cell culture were obtained from Merck‐Millipore.

The expression of LDH subunits in both cell lines was evaluated by RT‐PCR. RNA extraction, retro‐transcription and DNA amplification were performed as previously described (Rossi et al., ²⁰²³). For each culture, the relative expression ldh‐a/ldh‐b was evaluated. The primers used for the RT‐PCR reaction were: (a) for LDH‐A: 5′‐GCAACCCTGCAACGATTTT‐3′ (forward), and 5′‐TTCCAGAGGACAAGATCTCAAA‐3′ (reverse); (b) for LDH‐B: 5′‐CCAACCCAGTGGACATTCTT‐3′ (forward), and 5′‐AAACACCTGCCACATTCACA‐3′ (reverse).

5.8. Colorimetric assays of lactate secretion by cultured human cells

The competence of peptides in inhibiting LDH in cultured cells was tested by assessing the concentration of lactate released by MCF7 and BxPC3 cell cultures. To this aim, cells were seeded in duplicate in 24‐wells plates (2×10⁵/well) and let to adhere overnight; the culture medium was then replaced by Krebs‐Ringer buffer (300μl/well). Stock solutions of peptides (8mM in DMSO) were diluted in Krebs‐Ringer buffer to a final concentration of 640μM and mixed with an equal volume of 4% (v/v, in Krebs‐Ringer buffer) Lipofectamine 2000 (Invitrogen). The final solution was thoroughly mixed, kept for 25min at room temperature, and finally 100μl were added to each plate well, obtaining a final peptide concentration equal to 80μM. The concentration of lactate released in the Krebs–Ringer buffer was determined after 4h of incubation at 37°C, using the colorimetric assay previously reported (Rossi et al., ²⁰²³). Each experiment was performed in triplicate and included control samples consisting of untreated cell cultures exposed to the same final concentration of DMSO (1%, v/v) and Lipofectamine (0.5%, v/v) to which were exposed the samples treated with peptides.

5.9. Synthesis of peptides, general procedures

Unless otherwise stated, standard chemicals and solvents were purchased from commercial sources and used as received without further purification. The purity of target compounds was determined to be ≥95% by HPLC analyses, performed using an Agilent 1200 series apparatus, equipped with a Phenomenex reverse‐phase column (Gemini C18, 3μm, 110Å, 100×3.0mm, no. 00D4439‐Y0). Column description: stationary phase octadecyl‐carbon chain‐bonded silica (C18) with trimethylsilyl end‐cap, fully porous organo‐silica solid support, particle size 3μm, pore size 110Å, length 100mm, internal diameter 3mm; mobile phase for neutral compounds: from 9:1 H₂O/CH₃CN to 2:8 H₂O/CH₃CN in 20min at a flow rate of 1.0mlmin⁻¹, followed by 10min at the same composition; DAD (diode‐array detection) 210nm; mobile phase for ionizable peptides: from 9:1 H₂O/CH₃CN and 0.1% HCOOH to 2:8 H₂O/CH₃CN and 0.1% HCOOH in 20min, flow rate of 1.0mlmin⁻¹; DAD 254nm. Semipreparative RP HPLC was carried out with a Waters 2489 UV/visible Dual Detector equipped with a Waters 1525 Binary HPLC pump, using reverse‐phase column XSelect Peptide CSH C18 OBD column (Waters, 19×150mm, 5μm, no.186007021). Column description: stationary phase octadecyl‐carbon chain‐bonded silica (C18), double end‐capped, particle size 5μm, pore size 130Å, length 150mm, internal diameter 19mm; DAD 210nm, DAD 254nm. Mobile phase for neutral compounds: isocratic 6:4 H₂O/CH₃CN for 2min, then gradient from 6:4 H₂O/CH₃CN to 2:8 H₂O/CH₃CN in 10min, then isocratic 2:8 H₂O/CH₃CN for 2min; flow rate: 10mlmin⁻¹. Mobile phase for ionizable peptides: isocratic 6:4 H₂O/CH₃CN and 0.1% HCOOH for 2min, then gradient from 6:4 H₂O/CH₃CN and 0.1% HCOOH to 2:8 H₂O/CH₃CN and 0.1% HCOOH in 10min, then isocratic 2:8 H₂O/CH₃CN and 0.1% HCOOH for 2min. Routine ESI MS analysis was carried out using an MS single quadrupole HP 1200 MSD detector, with a drying gas flow of 12.5Lmin⁻¹, nebulizer pressure 30 psig, drying gas temperature 350°C, capillary voltage 4500 (+) and 4000 (−), scan 50–2600amu. NMR spectra were recorded with a Bruker BioSpin GmbH (¹H: 600MHz, ¹³C: 151MHz) at 298K in 5mm tubes, using 0.01M peptide. Chemical shifts are reported in ppm (δ) and internally referenced with (CD₃)₂SO: ¹H: 2.50, ¹³C: 39.52ppm. The unambiguous assignment of ¹H NMR resonances was based on 2D gCOSY experiments. Coupling constants (J) are reported in Hz.

The NMR spectra and the HPLC chromatograms of the synthesized peptides are reported in Figures S5a–q and S6a–c, respectively.

5.10. Solid phase synthesis, general procedure for linear peptides

Solid‐phase peptide synthesis was performed in polypropylene syringes fitted with a polyethylene porous disc. The linear peptides were assembled manually on Wang resin (0.3g, 1.1mmol/g loading capacity) using Fmoc‐protected amino acids under standard procedures; (S)‐ or (R)‐Asp was introduced as Fmoc‐Asp(OBn)OH, or Fmoc‐Asp(OBn); Lys was introduced as Fmoc‐Lys(Boc)OH.

Prior to use, the resin was swollen in DMF (3ml) for 15min. In a separate sample tube, (S)‐ or (R)‐Fmoc‐AA‐OH (0.6mmol) and HOBT (81mg, 0.6mmol) were dissolved in DMF (4ml). After 20min, the mixture was added to the resin, followed by DCC (124mg, 0.6mmol) and a catalytic amount of DMAP, and the resin was gently shaken at RT for 3h. Thereafter, a mixture of Ac₂O (0.92ml, 10mmol) and pyridine (0.81ml, 10mmol) was added and shaken for additional 30min to end‐cap the unreacted 4‐hydroxybenzyl alcohol linkers. The resin was filtered and washed alternatively with DMF, MeOH, and DCM (3×4ml each).

Fmoc cleavage was carried out using 20% (v/v) piperidine in DMF (5ml), while gently shaking at RT for 20min. After washing with DMF and DCM (5ml), the deprotection was repeated. The resin was then washed sequentially with DMF, MeOH, and DCM (3× 4ml each).

The subsequent coupling reactions were performed by dissolving in a separate vial Fmoc‐protected amino acids (0.6mmol) and HOBt (81mg, 0.6mmol) in DMF (4ml) for 20min. The mixture was poured into the reactor followed by DCC (124mg, 0.6mmol), and the suspension was shaken at RT for 3h. Coupling efficacy was monitored by the Kaiser test. Fmoc cleavage was carried out as reported above.

Cleavage from the resin and simultaneous removal of the acid‐labile protecting groups was performed by using a 95:2.5:2.5v/v/v mixture of TFA/TIPS/H₂O (10ml) while shaking for 2.5h at RT. The mixture was filtered and the resin washed twice with 5% TFA in Et₂O (10ml). The filtrates were collected and solvents were removed under reduced pressure. Then ice‐cold Et₂O was added to precipitate the crude peptides as TFA salts, which were recovered by centrifuge. The peptides were isolated by RP HPLC on a semipreparative C18 column. Linear sequences destined to cyclization were utilized without further purifications. The purity and the identity of the products were determined to be >95% by RP HPLC coupled to ESI MS, by ¹H and ¹³C NMR.

5.11. Synthesis of cyclopeptides, general procedure

The cyclization of the crude peptides was performed under pseudo‐high dilution conditions, by slowly adding the peptide using a temporized syringe pump (dual‐channel KD Scientific model 200). A solution of the linear peptide (0.15mmol) in DMF (10ml) was added to a mixture of NaHCO₃ (38mg, 0.45mmol) and DPPA (65μl, 0.3mmol) in DMF (4ml) at RT over 16h. Once the addition was complete, the reaction was stirred for additional 6h. Then the solvent was distilled under reduced pressure, and the residue was suspended in water (5ml), and extracted 3 times with EtOAc (20ml). The combined organic solvent was removed at reduced pressure, and the crude peptides were isolated by RP HPLC on a semipreparative C18 column.

Removal of benzyl protecting groups was performed by catalytic hydrogenation. A stirred suspension of the protected peptides (0.1mmol) and a catalytic amount of 10% (w/w) Pd/C in absolute EtOH (10ml) was stirred under H₂ atmosphere at RT for 12h. Thereafter, the catalyst was filtered off over Celite and the solvent was distilled under reduced pressure, to afford the products in quantitative yield. The purity and the identity of the final products were determined to be >95% by RP HPLC coupled to ESI MS, by ¹H and ¹³C NMR, and by 2D gCOSY experiments at 600MHz in DMSO‐d ₆ .

5.12. Analytical characterization of synthesized peptides

H‐Gly‐Gln‐Asn‐Gly‐Ile‐Ser‐Asp‐Leu‐OH (TH1). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.56 (d, J=7.8Hz, 1H, GlnNH), 8.37 (d, J=7.7Hz, 1H, AsnNH), 8.16 (d, J=8.2Hz, 1H, AspNH), 8.03 (d, J=7.6Hz, 1H, SerNH), 7.99 (t, J=6.0Hz, 1H, GlyNH), 7.94 (br s, 2H, GlyNH₂), 7.87 (d, J=8.0Hz, 1H, LeuNH), 7.85 (d, J=8.2Hz, 1H, IleNH),7.38 (br s, 1H, Asn‐CONH₂), 7.23 (br s, 1H, Gln‐CONH₂), 6.91 (br s, 1H, Asn‐CONH₂), 6.77 (br s, 1H, Gln‐CONH₂), 5.10 (t, J=6.0Hz, 1H, SerOH), 4.62 (td, J=7.8, 5.4Hz, 1H, AspHα), 4.57–4.52 (m, 1H, AsnHα), 4.36 (td, J=7.8, 5.7Hz, 1H, GlnHα), 4.32 (dt, J=7.7, 6.1Hz, 1H, SerHα), 4.23 (dd, J=8.8, 7.4Hz, 1H, IleHα), 4.20–4.15 (m, 1H, LeuHα), 3.78 (dd, J=16.9, 5.8Hz, 1H, GlyHα), 3.71 (dd, J=16.9, 5.8Hz, 1H, GlyHα), 3.64–3.56 (m, GlyHα+SerHβ), 3.56–3.50 (m, 1H, SerHβ), 2.68 (dd, J=16.7, 5.4Hz, 1H, AspHβ), 2.60–2.51 (m, 2H, AsnHβ+AspHβ), 2.43 (dd, J=15.5, 7.7Hz, 1H, AsnHβ), 2.10 (t, J=8.0Hz, 2H, GlnHγ), 1.88 (dt, J=13.8, 7.5Hz, 1H, GlnHβ), 1.78–1.70 (m, 2H, GlnHβ+IleHβ), 1.65–1.59 (m, 1H, LeuHγ), 1.53–1.46 (m, 2H, LeuHβ), 1.43–1.37 (m, 1H, IleHγ), 1.08–1.03 (m, 1H, IleHγ), 0.88 (d, J=6.6Hz, 3H, LeuHδ‐CH₃), 0.82 (d, J=6.6Hz, 6H, LeuHδ‐CH₃+IleHγ‐CH₃), 0.80 (t, J=7.8Hz, 3H, IleHδ‐CH₃). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.70, 173.64, 171.77, 171.44, 171.05, 170.95, 170.70, 170.45, 169.82, 168.56, 165.85, 61.88, 56.78, 54.79, 52.21, 50.41, 49.81, 49.30, 42.11, 37.06, 36.66, 35.96, 31.15, 28.29, 27.15, 24.27, 24.11, 22.85, 21.37, 15.34, 10.99. ESI MS m/z calcd. for [C₃₂H₅₅N₁₀O₁₄]⁺ 803.4, found 803.3 [M+H]⁺.

H‐Gly‐Gln‐Asn‐Asp‐OH (TH16). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.56 (d, J=8.0Hz, 1H, GlnNH), 8.33 (d, J=7.8Hz, 1H, AsnNH), 8.01 (d, J=8.0Hz, 1H, AspNH), 7.35 (br s, 1H, Asn‐CONH₂), 7.24 (br s, 1H, Gln‐CONH₂), 6.89 (br s, 1H, Asn‐CONH₂), 6.79 (br s, 1H, Gln‐CONH₂), 4.58 (qd, J=7.9, 4.9Hz, 1H, AsnHα), 4.45 (q, J=6.9Hz, 1H, AspHα), 4.37 (td, J=7.9, 5.6Hz, 1H, GlnHα), 3.59 (d, J=9.4Hz, 2H, GlyHα), 2.62–2.54 (m, 3H, AspHβ+AsnHβ), 2.42–2.35 (m, 1H, AsnHβ), 2.11 (t, J=8.0Hz, 2H, GlnHγ), 1.89 (dq, J=14.1, 7.2Hz, 1H, GlnHβ), 1.75 (dt, J=14.0, 7.6Hz, 1H, GlnHβ). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.81, 172.48, 171.90, 171.27, 170.65, 170.63, 165.81, 52.11, 49.58, 48.70, 43.72, 37.10, 34.32, 31.21, 28.45. ESI MS m/z calcd. for [C₁₅H₂₅N₆O₉]⁺ 433.2, found 432.9 [M+H]⁺.

H‐Gly‐Gln‐Asn‐d‐Asp‐OH (TH17). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.56 (d, J=8.2Hz, 1H, GlnNH), 8.33 (d, J=7.9Hz, 1H, AsnNH), 8.06 (d, J=8.0Hz, 1H, AspNH), 7.98 (br t, J=5.7Hz, 2H, GlyNH₂), 7.33 (br s, 1H, Asn‐CONH₂), 7.18 (br s, 1H, Gln‐CONH₂), 6.88 (br s, 1H, Asn‐CONH₂), 6.79 (br s, 1H, Gln‐CONH₂), 4.61 (td, J=8.1, 5.4Hz, 1H, AsnHα), 4.51 (dt, J=8.1, 6.0Hz, 1H, AspHα), 4.39 (td, J=8.1, 5.5Hz, 1H, GlnHα), 3.59 (br d, J=5.1Hz, 2H, GlyHα), 2.68 (dd, J=16.7, 5.9Hz, 1H, AspHβ), 2.60 (dd, J=16.6, 6.1Hz, 1H, AspHβ), 2.53–2.51 (m, 1H, AsnHβ), 2.35 (dd, J=15.5, 8.2Hz, 1H, AsnHβ), 2.10 (t, J=8.0Hz, 2H, GlnHγ), 1.89 (dtd, J=13.5, 7.9, 5.6Hz, 1H, GlnHβ), 1.74 (dq, J=13.6, 8.0Hz, 1H, GlnHβ). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.73, 172.13, 171.73, 171.12, 170.61, 170.58, 165.73, 51.99, 49.47, 48.58, 43.73, 37.22, 36.01, 31.20, 28.51. ESI MS m/z calcd. for [C₁₅H₂₅N₆O₉]⁺ 433.2, found 432.9 [M+H]⁺.

H‐Gly‐Gln‐Asn‐d‐Asp‐OBn (TH7). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.54 (d, J=8.2Hz, 1H, GlnNH), 8.32 (d, J=7.9Hz, 1H, AsnNH), 8.29 (d, J=8.0Hz, 1H, AspNH), 7.40–7.30 (m, 6H, Bn‐aromatic+Asn‐CONH₂), 7.20 (br s, 1H, Gln‐CONH₂), 6.89 (br s, 1H, Asn‐CONH₂), 6.80 (br s, 1H, Gln‐CONH₂), 5.13 (d, J=12.6Hz, 1H, Bn‐CH₂), 5.09 (d, J=12.6Hz, 1H, Bn‐CH₂), 4.67–4.58 (m, 2H, AspHα+AsnHα), 4.37 (td, J=8.2, 5.5Hz, 1H, GlnHα), 3.59 (s, 2H, GlyHα), 2.73 (dd, J=16.9, 6.1Hz, 1H, AspHβ), 2.64 (dd, J=16.8, 6.2Hz, 1H, AspHβ), 2.49–2.46 (m, 1H, AsnHβ), 2.37 (dd, J=15.5, 8.3Hz, 1H, AsnHβ), 2.10 (t, J=8.0Hz, 2H, GlnHγ), 1.93–1.85 (m, 1H, GlnHβ), 1.74 (dq, J=13.4, 8.0Hz, 1H, GlnHβ). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.69, 171.67, 171.05, 170.86, 170.61, 170.54, 165.81, 135.84, 128.41, 127.94, 127.57, 66.15, 52.07, 49.53, 48.74, 43.72, 37.20, 35.91, 31.24, 28.49. ESI MS m/z calcd. for [C₂₂H₃₁N₆O₉]⁺ 523.2, found 523.2 [M+H]⁺.

c[Gly‐Gln‐Asn‐isoAsp] (TH2). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.40 (t, J=6.0Hz, 1H, GlyNH), 8.06 (d, J=7.7Hz, 1H, AspNH), 7.56 (d, J=8.6Hz, 1H, GlnNH), 7.31 (br s, 1H, Asn‐CONH₂), 7.22 (br s, 1H, Gln‐CONH₂), 6.90 (d, J=8.9Hz, 1H, AsnNH), 6.76 (br s, 1H, Gln‐CONH₂), 6.74 (br s, 1H, Asn‐CONH₂), 4.57 (dt, J=8.9, 5.3Hz, 1H, AsnHα), 4.40 (td, J=7.8, 5.6Hz, 1H, AspHα), 4.09 (td, J=8.6, 6.7Hz, 1H, GlnHα), 3.66 (dd, J=14.6, 6.3Hz, 1H, GlyHα), 3.48 (dd, J=15.0, 6.0Hz, 1H, GlyHα), 2.81–2.72 (m, 2H, AsnHβ+AspHβ), 2.56 (dd, J=15.5, 5.1Hz, 1H, AsnHβ), 2.30 (dd, J=15.4, 5.7Hz, 1H, AspHβ), 2.04 (dt, J=9.0, 6.0Hz, 2H, GlnHγ), 1.79–1.66 (m, 2H, GlnHβ). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.30, 172.28, 171.81, 170.93, 170.36, 169.45, 169.32, 54.04, 49.58, 48.47, 44.17, 36.87, 35.45, 31.39, 27.33. ESI MS m/z calcd. for [C₁₅H₂₃N₆O₈]⁺ 415.4, found 415.4 [M+H]⁺.

c[Gly‐Gln‐Asn‐isoAsp(OBn)] (TH10). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.45 (t, J=6.1Hz, 1H, GlyNH), 8.04 (d, J=7.7Hz, 1H, AspNH), 7.62 (d, J=8.6Hz, 1H, GlnNH), 7.38–7.30 (m, 6H, Bn‐aromatic+Asn‐CONH₂), 7.23 (br s, 1H, Gln‐CONH₂), 7.14 (d, J=8.9Hz, 1H, AsnNH), 6.77 (br s, 1H, Asn‐CONH₂), 6.74 (br s, 1H, Gln‐CONH₂), 5.13 (s, 2H, Bn‐CH₂), 4.76 (dt, J=8.9, 5.5Hz, 1H, AsnHα), 4.40 (td, J=7.8, 5.8Hz, 1H, AspHα), 4.09 (td, J=8.7, 6.7Hz, 1H, GlnHα), 3.72 (dd, J=14.5, 6.5Hz, 1H, GlyHα), 3.48–3.46 (m, 1H, GlyHα), 2.80 (dd, J=15.5, 6.1Hz, 1H, AsnHβ), 2.74 (dd, J=15.5, 7.9Hz, 1H, AspHβ), 2.61 (dd, J=15.5, 4.9Hz, 1H, AsnHβ), 2.32 (dd, J=15.4, 5.8Hz, 1H, AspHβ), 2.09–2.00 (m, 2H, GlnHγ), 1.77 (ddt, J=13.6, 9.1, 6.7Hz, 1H, GlnHβ), 1.70 (ddt, J=15.3, 8.9, 4.3Hz, 1H, GlnHβ). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.32, 171.80, 171.00, 170.72, 170.18, 169.56, 169.42, 135.90, 128.41, 127.94, 127.59, 64.91, 54.02, 49.71, 48.83, 44.18, 36.92, 35.40, 31.39, 27.27. ESI MS m/z calcd. for [C₂₂H₂₉N₆O₈]⁺ 505.2, found 505.2 [M+H]⁺.

c[Gly‐Gln‐Asn‐Asp(OBn)] (TH15). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.48 (t, J=6.2Hz, 1H, GlyNH), 8.06 (d, J=7.7Hz, 1H, AspNH), 7.65 (d, J=8.6Hz, 1H, GlnNH), 7.38–7.30 (m, 6H, Bn‐aromatic+Asn‐CONH₂), 7.22 (br s, 1H, Gln‐CONH₂), 7.13 (d, J=8.8Hz, 1H, AsnNH), 6.76 (br s, 1H, Asn‐CONH₂), 6.74 (br s, 1H, Gln‐CONH₂), 5.13 (s, 2H, Bn‐CH₂), 4.75 (dt, J=9.0, 5.5Hz, 1H, AsnHα), 4.40 (td, J=7.8, 5.7Hz, 1H, AspHα), 4.09 (td, J=8.6, 6.7Hz, 1H, GlnHα), 3.71 (dd, J=14.5, 6.5Hz, 1H, GlyHα), 3.46 (dd, J=14.4, 6.0Hz, 1H, GlyHα), 2.80 (dd, J=15.5, 6.1Hz, 1H, AsnHβ), 2.74 (dd, J=15.6, 7.8Hz, 1H, AspHβ), 2.63–2.60 (m, 1H, AsnHβ), 2.32 (dd, J=15.6, 6.0Hz, 1H, AspHβ), 2.04 (dt, J=8.9, 6.0Hz, 2H, GlnHγ), 1.79–1.67 (m, 2H, GlnHβ). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.32, 171.80, 171.01, 170.71, 170.17, 169.57, 169.43, 135.91, 128.41, 127.94, 127.59, 66.12, 54.03, 49.69, 48.83, 44.18, 36.92, 35.42, 31.39, 27.27. ESI MS m/z calcd. for [C₂₂H₂₉N₆O₈]⁺ 505.2, found 505.2 [M+H]⁺.

c[Gly‐Gln‐Asn‐d‐isoAsp] (TH3). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.51 (t, J=6.1Hz, 1H, GlyNH), 7.70–7.63 (m, 2H, AspNH+AsnNH), 7.61 (d, J=9.6Hz, 1H, GlnNH), 7.44 (br s, 1H, Asn‐CONH₂), 7.25 (br s, 1H, Gln‐CONH₂), 6.91 (br s, 1H, Asn‐CONH₂), 6.76 (br s, 1H, Gln‐CONH₂), 4.51 (td, J=9.6, 4.8Hz, 1H, AsnHα), 4.28 (ddd, J=11.8, 7.4, 4.2Hz, 1H, AspHα), 4.18 (td, J=9.4, 7.0Hz, 1H, GlnHα), 3.67 (dd, J=15.8, 6.0Hz, 1H, GlyHα), 3.55 (dd, J=15.8, 6.1Hz, 1H, GlyHα), 2.63 (dd, J=14.2, 4.2Hz, 1H, AspHβ), 2.55–2.51 (m, 1H, AspHβ), 2.49–2.46 (m, 1H, AsnHβ), 2.33 (dd, J=14.8, 9.8Hz, 1H, AsnHβ), 2.04 (dt, J=8.6, 6.0Hz, 2H, GlnHγ), 1.84–1.73 (m, 2H, GlnHβ). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.27, 172.61, 171.60, 170.69, 169.64, 169.18, 169.14, 54.26, 50.82, 50.05, 43.47, 37.25, 36.26, 31.21, 26.73. ESI MS m/z calcd. for [C₁₅H₂₃N₆O₈]⁺ 415.4, found 415.4 [M+H]⁺.

H‐Gly‐Gln‐Asn‐Asp(OBn)‐OH (TH14). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.54 (d, J=8.0Hz, 1H, GlnNH), 8.29 (d, J=7.9Hz, 1H, AsnNH), 8.23 (d, J=8.0Hz, 1H, AspNH), 7.40–7.27 (m, 6H, Bn‐aromatic+Asn‐CONH₂), 7.23 (br s, 1H, Gln‐CONH₂), 6.89 (br s, 1H, Asn‐CONH₂), 6.79 (br s, 1H, Gln‐CONH₂), 5.10 (br d, J=2.3Hz, 2H, Bn‐CH₂), 4.64 (q, J=6.5Hz, 1H, AspHα), 4.59 (td, J=8.1, 5.1Hz, 1H, AsnHα), 4.33 (q, J=7.4Hz, 1H, GlnHα), 3.57 (s, 2H, GlyHα), 2.65 (d, J=6.0Hz, 2H, AspHβ), 2.55–2.52 (m, 1H, AsnHβ), 2.38 (dd, J=15.4, 8.6Hz, 1H, AsnHβ), 2.10 (t, J=8.0Hz, 2H, GlnHγ), 1.88 (dq, J=14.3, 7.6Hz, 1H, GlnHβ), 1.74 (dt, J=14.1, 7.8Hz, 1H, GlnHβ). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.74, 171.81, 171.18, 170.96, 170.75, 170.65, 165.94, 135.89, 128.42, 127.95, 127.60, 66.11, 54.92, 52.16, 49.47, 48.82, 37.07, 36.09, 31.22, 28.39. ESI MS m/z calcd. for [C₂₂H₃₁N₆O₉]⁺ 523.2, found 523.2 [M+H]⁺.

c[Gly‐Gln‐Asn‐d‐isoAsp(OBn)] (TH11). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.53 (t, J=6.1Hz, 1H, GlyNH), 7.83 (d, J=7.2Hz, 1H, AspNH), 7.72–7.60 (m, 2H, AsnNH+GlnNH), 7.45 (br s, 1H, Asn‐CONH₂), 7.39–7.24 (m, 6H, Bn‐aromatic+Gln‐CONH₂), 6.92 (br s, 1H, Asn‐CONH₂), 6.76 (br s, 1H, Gln‐CONH₂), 5.15 (d, J=12.6Hz, 1H, Bn‐CH₂), 5.12 (d, J=12.6Hz, 1H, Bn‐CH₂), 4.52 (td, J=9.4, 4.9Hz, 1H, AsnHα), 4.41 (ddd, J=11.7, 7.2, 4.0Hz, 1H, AspHα), 4.18 (q, J=8.6Hz, 1H, GlnHα), 3.68 (dd, J=15.8, 6.1Hz, 1H, GlyHα), 3.53 (dd, J=15.9, 6.2Hz, 1H, GlyHα), 2.67 (dd, J=14.2, 4.1Hz, 1H, AspHβ), 2.59–2.54 (m, 1H, AspHβ), 2.48–2.45 (m, 1H, AsnHβ), 2.31 (dd, J=14.8, 9.5Hz, 1H, AsnHβ), 2.03 (q, J=6.9Hz, 2H, GlnHγ), 1.77 (q, J=7.9Hz, 2H, GlnHβ). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.25, 171.76, 170.91, 170.72, 169.71, 169.13, 168.83, 135.83, 128.45, 128.06, 127.77, 66.17, 54.23, 50.78, 50.27, 43.52, 37.13, 36.06, 31.20, 26.71. ESI MS m/z calcd. for [C₂₂H₂₉N₆O₈]⁺ 505.2, found 505.2 [M+H]⁺.

H‐Gly‐Gln‐Asn‐Asp‐OBn (TH6). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.54 (d, J=8.1Hz, 1H, GlnNH), 8.33–8.25 (m, 2H, AsnNH+AspNH), 7.42–7.27 (m, 6H, Bn‐aromatic+Asn‐CONH₂), 7.22 (br s, 1H, Gln‐CONH₂), 6.90 (br s, 1H, Asn‐CONH₂), 6.80 (br s, 1H, Gln‐CONH₂), 5.11 (d, J=12.6Hz, 1H, Bn‐CH₂), 5.09 (d, J=12.6Hz, 1H, Bn‐CH₂), 4.65 (dt, J=8.1, 6.2Hz, 1H, AspHα), 4.60 (td, J=8.1, 4.9Hz, 1H, AsnHα), 4.36 (td, J=8.0, 5.6Hz, 1H, GlnHα), 3.58 (s, 2H, GlyHα), 2.67 (qd, J=16.8, 6.1Hz, 2H, AspHβ), 2.54–2.51 (m, 1H, AsnHβ), 2.38 (dd, J=15.7, 8.5Hz, 1H, AsnHβ), 2.10 (t, J=8.0Hz, 2H, GlnHγ), 1.88 (dtd, J=16.1, 7.6, 5.7Hz, 1H, GlnHβ), 1.73 (dq, J=13.4, 8.0Hz, 1H, GlnHβ). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.73, 171.63, 171.08, 171.02, 170.66, 170.59, 165.80, 135.86, 128.41, 127.96, 127.61, 66.14, 52.02, 49.43, 48.75, 40.06, 37.11, 35.89, 31.21, 28.50. ESI MS m/z calcd. for [C₂₂H₃₁N₆O₉]⁺ 523.2, found 523.2 [M+H]⁺.

H‐Lys‐Ser‐Asp‐d‐Leu‐OH (TH19). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.66 (d, J=7.9Hz, 1H, SerNH), 8.45 (d, J=7.7Hz, 1H, AspNH), 8.19 (d, J=5.0Hz, 2H, Lys‐αNH₂), 7.96 (d, J=8.2Hz, 1H, LeuNH), 7.82 (t, J=5.8Hz, 2H, Lys‐NH₂), 4.60 (td, J=8.0, 4.9Hz, 1H, AspHα), 4.44 (q, J=6.6Hz, 1H, SerHα), 4.21 (ddd, J=10.3, 8.1, 4.6Hz, 1H, LeuHα), 3.85 (q, J=5.9Hz, 1H, LysHα), 3.69 (dd, J=10.5, 6.0Hz, 1H, SerHβ), 3.50 (dd, J=10.5, 6.8Hz, 1H, SerHβ), 2.80–2.75 (m, 2H, LysH), 2.72–2.67 (m, 1H, AspHβ), 2.55 (dd, J=16.7, 8.3Hz, 1H, AspHβ), 1.71 (dt, J=10.9, 6.6Hz, 2H, LysHβ), 1.64–1.51 (m, 4H, LysHδ+LeuHγ+LeuHβ), 1.48–1.43 (m, 1H, LeuHβ), 1.38–1.32 (m, 2H, LysHγ), 0.85 (d, J=6.3Hz, 3H, LeuHδ‐CH₃), 0.80 (d, J=6.4Hz, 3H, LeuHδ‐CH₃). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.87, 171.73, 170.42, 169.81, 168.64, 62.04, 54.68, 52.00, 50.43, 49.82, 38.61, 36.22, 30.59, 26.57, 24.22, 22.96, 21.22, 21.20. ESI MS m/z calcd. for [C₁₉H₃₆N₅O₈]⁺ 462.2, found 462.0 [M+H]⁺.

H‐Lys‐Ser‐Asp‐Leu‐OH (TH18). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.65 (d, J=7.8Hz, 1H, SerNH), 8.38 (d, J=8.1Hz, 1H, AspNH), 8.16 (d, J=5.4Hz, 2H, Lys‐αNH₂), 7.95 (d, J=8.0Hz, 1H, LeuNH), 7.78 (t, J=5.9Hz, 2H, Lys‐NH₂), 4.64 (td, J=8.1, 5.0Hz, 1H, AspHα), 4.42 (dt, J=8.0, 6.2Hz, 1H, SerHα), 4.18 (ddd, J=9.9, 8.0, 5.1Hz, 1H, LeuHα), 3.86–3.83 (m, 1H, LysHα), 3.66 (dd, J=10.7, 6.1Hz, 1H, SerHβ), 3.57 (dd, J=10.7, 6.3Hz, 1H, SerHβ), 2.76 (dt, J=10.2, 5.9Hz, 2H, LysH), 2.70 (dd, J=16.8, 5.0Hz, 1H, AspHβ), 2.57–2.51 (m, 1H, AspHβ), 1.73–1.62 (m, 2H, LysHβ), 1.60–1.44 (m, 5H, LysHδ+LeuHγ+LeuHβ), 1.41–1.30 (m, 2H, LysHγ), 0.88 (d, J=6.6Hz, 3H, LeuHδ‐CH₃), 0.83 (d, J=6.5Hz, 3H, LeuHδ‐CH₃). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.72, 171.69, 170.52, 169.53, 168.49, 64.94, 54.75, 51.89, 50.45, 49.38, 38.52, 35.98, 30.53, 26.49, 24.18, 22.88, 21.35, 21.10. ESI MS m/z calcd. for [C₁₉H₃₆N₅O₈]⁺ 462.2, found 462.0 [M+H]⁺.

c[isoLys‐Ser‐Asp‐d‐Leu] (TH5). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.75 (br s, 1H, SerNH), 8.20 (d, J=7.9Hz, 1H, AspNH), 7.62 (d, J=9.3Hz, 1H, LeuNH), 7.56 (br d, J=6.9Hz, 1H, Lys‐NH), 4.36–4.17 (m, 3H, SerHα+AspHα+LeuHα), 3.72 (dd, J=11.3, 5.5Hz, 1H, SerHβ), 3.64 (dd, J=8.7, 4.0Hz, 1H, LysHα), 3.58 (dd, J=11.4, 3.9Hz, 1H, SerHβ), 3.35–3.30 (m, 1H, LysH), 2.80–2.72 (m, 1H, LysH), 2.65 (dd, J=16.2, 5.3Hz, 1H, AspHβ), 2.40 (dd, J=16.2, 5.1Hz, 1H, AspHβ), 1.68–1.64 (m, 2H, LeuHβ+LysHβ), 1.57–1.45 (m, 4H, LysHβ+LeuHγ+LysHδ+LeuHβ), 1.40–1.25 (m, 3H, LysHδ+LysHγ), 0.86 (d, J=6.5Hz, 3H, LeuHδ‐CH3), 0.80 (d, J=6.4Hz, 3H, LeuHδ‐CH3). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.72, 172.89, 171.45, 170.83, 170.16, 64.91, 56.71, 52.94, 50.62, 50.33, 37.85, 37.71, 32.13, 26.83, 24.23, 23.32, 21.07, 20.78. ESI MS m/z calcd. for [C₁₉H₃₄N₅O₇]⁺ 444.2, found 444.1 [M+H]⁺.

c[isoLys‐Ser‐Asp‐Leu] (TH4). ¹H NMR (600MHz, DMSO‐d ₆) δ 8.51 (d, J=7.6Hz, 1H, LeuNH), 8.36 (br s, 1H, SerNH), 8.32 (br s, 1H, AspNH), 8.04 (t, J=5.6Hz, 1H, Lys‐NH), 4.26–4.16 (m, 2H, SerHα+AspHα), 3.99 (ddd, J=11.2, 7.5, 4.6Hz, 1H, LeuHα), 3.68 (dd, J=11.3, 5.6Hz, 1H, SerHβ), 3.59 (dd, J=11.5, 4.8Hz, 1H, SerHβ), 3.25 (dd, J=8.8, 3.6Hz, 1H, LysHα), 3.20–3.12 (m, 1H, LysH), 2.92–2.83 (m, 1H, LysH), 2.59 (dd, J=15.6, 4.9Hz, 1H, AspHβ), 2.21 (dd, J=15.5, 5.3Hz, 1H, AspHβ), 1.66–1.61 (m, 1H, LeuHγ), 1.56–1.48 (m, 3H, LeuHβ+LysHβ), 1.41–1.31 (m, 3H, LysHβ+LysHδ), 1.26–1.13 (m, 2H, LysHγ), 0.85 (d, J=6.5Hz, 3H, LeuHδ‐CH3), 0.78 (d, J=6.4Hz, 3H, LeuHδ‐CH3). ¹³C NMR (151MHz, DMSO‐d ₆) δ 173.35, 172.82, 171.82, 171.58, 170.13, 64.90, 56.13, 54.22, 52.50, 51.51, 38.67, 36.13, 28.44, 24.29, 23.13, 21.93, 21.07, 17.26. ESI MS m/z calcd. for [C₁₉H₃₄N₅O₇]⁺ 444.2, found 444.1 [M+H]⁺.

This project was supported by MIUR programs PRIN2020833Y75 and Department of Excellence L 232 December 1, 2016. Support by Fondazione CaRisBo (project 18668) is also acknowledged. Tingting He was supported by China Scholarship Council (202106050026). Open access publishing facilitated by Universita degli Studi di Bologna, as part of the Wiley ‐ CRUI‐CARE agreement.