ChIPs.

The experiments were conducted as previously described (53), with the following modifications. Cells cross-linked with formaldehyde were sonicated for 12 cycles of 30 s at 4°C with at least 30-s cooling on ice per cycle. The primer set 5′ TGAAATGCCTGGTGTCAACT 3′ (sense) and 5′ TCTATGCAATCTTGCCAAAG 3′) (antisense) was used to amplify sequences −4724 to −4557 relative to the SER3 ATG codon (SER3_−4.5kb). The primers used to amplify nucleotides −198 to −43 at the SNZ1 promoter were 5′ TAGCGCCGCCATTTCTTCAT 3′ (sense) and 5′ TCGTTCCTAAAGGTTTCTCC 3′ (antisense). The primers used to amplify the ARG1 upstream activation sequence (UAS) and POL1 open reading frame (ORF) were described previously (53). The PCR conditions were as follows: initial denaturation at 94°C for 4 min, followed by 27 cycles of 94°C for 30 s, 52°C for 30 s, 65°C for 1 min, and a final extension for 5 min at 65°C.

Recruitment of SWI/SNF is dependent on the Gcn4p activation domain, but promoter binding by Gcn4p is independent of SWI/SNF.

In vitro interaction between Gcn4p and the SWI/SNF complex is strongly dependent on bulky hydrophobic clusters in the Gcn4p activation domain, and multiple clusters must be inactivated to observe a strong defect in SWI/SNF binding (35). To determine whether the hydrophobic clusters are required for recruitment of SWI/SNF by Gcn4p in vivo, we conducted ChIP experiments using the SNF2-myc gcn4Δ and SNF5-myc gcn4Δ strains described above harboring plasmids containing GCN4 or gcn4-14Ala (or the corresponding HA-tagged versions of these alleles). The gcn4-14Ala allele contains 14 alanine substitutions in the 7 hydrophobic clusters in the Gcn4p activation domain that contribute to transcriptional activation in vivo (22). As shown in Fig. 3A and B, we consistently observed greater binding of myc-Snf2p and myc-Snf5p to the ARG1 and SNZ1 promoters and greater binding of myc-Snf2p at ARG1 in the strains harboring GCN4 than in those with gcn4-14Ala.

It was conceivable that the 14 Ala substitutions in the activation domain reduce SWI/SNF recruitment by impairing the binding of Gcn4p to the ARG1 and SNZ1 promoters. As shown in Fig. 3C and D, similar or even greater amounts of ARG1 and SNZ1 promoter sequences were immunoprecipitated with myc-gcn4p-14Ala than with myc-Gcn4p when these proteins were expressed from single-copy plasmids (Fig. ​(Fig.3C,3C, compare lanes 2 and 9; Fig. ​Fig.3D,3D, compare lanes 2 and 9). The somewhat higher level of promoter binding observed for the 14Ala mutant protein can be attributed to its higher steady-state level, as determined by Western blot analysis (data not shown). Higher steady-state levels are frequently observed for Gcn4 proteins with mutations in the activation domain (22).

The results shown in Figs. 3C to D also reveal that deletions of SWI/SNF subunits have little or no effect on binding of myc-tagged Gcn4p to the ARG1 and SNZ1 promoters. This finding is especially important for the snf2Δ mutant, which lacks the ATPase subunit of the complex. Hence, WT binding of Gcn4p at these promoters does not depend on prior nucleosome remodeling by SWI/SNF, nor does Gcn4p binding require prior interaction of any cofactors with the activation domain in a manner that depends on the hydrophobic clusters.

Recruitment of SWI/SNF by Gcn4p is independent of Snf2p but requires Snf5p, Snf6p, and Swi3p.

It was shown previously that Swi2p/Snf2p, Snf5p, and Swi1p were photo-cross-linked to Gcn4p in the context of intact SWI/SNF and that each recombinant subunit can interact directly with recombinant Gcn4p in vitro (37). We wished to determine whether these interactions are necessary or sufficient for recruitment of the SWI/SNF complex to the ARG1 and SNZ1 promoters in vivo. Towards this end, we constructed a panel of six strains harboring deletions of SNF6, SNF5, SWI3, SNF11, SWP73 or SNF2 for each of the six strains containing a different myc-tagged subunit (myc-Snf2p, myc-Snf5p, myc-Swp73, myc-Swi3p, myc-Snf6p, and myc-Swi1p). The resulting 31 strains, along with the 12 tagged strains containing all WT SWI/SNF subunits (WT and gcn4), were subjected to ChIP analysis as described above.

The results shown in Fig. 4A through F indicate that the snf6Δ, snf5Δ, and swi3Δ strains consistently showed marked reductions in the Gcn4p-dependent recruitment of all tagged SWI/SNF subunits to the ARG1 UAS. Recruitment was not completely eliminated by any of these mutations, as the residual binding was consistently higher than that seen in the gcn4Δ strain lacking the activator. By contrast, the snf11Δ, swp73Δ, and snf2Δ strains showed little or no reduction in binding of all SWI/SNF subunits to ARG1. Similar results were obtained when we analyzed binding to SNZ1 except that the snf6Δ and swi3Δ mutations greatly reduced myc-Snf5p binding to the same low level observed in the gcn4Δ strain. Moreover, the binding of all tagged SWI/SNF subunits to this promoter was impaired by swp73Δ (Fig. 5A and B), even though this mutation had little or no effect on SWI/SNF recruitment to ARG1 (Fig. ​(Fig.4).4). Even though Snf2p, Snf5p, and Swi1p are capable of direct binding to Gcn4p in vitro (37), the data in Fig. ​Fig.44 and ​and55 suggest that high-level recruitment of these proteins is dependent on SWI/SNF subunits Snf6p, Snf5p, and Swi3p. Interestingly, it appears that interactions between Gcn4p and Snf2p are dispensable for recruitment of other SWI/SNF subunits in vivo.

Open in a separate window

FIG. 4.

Recruitment of SWI/SNF subunits by Gcn4p to ARG1 is impaired in snf6Δ, snf5Δ, and swi3Δ mutants. (A through F) We generated a panel of strains harboring the chromosomal myc-tagged SWI/SNF alleles designated in the upper left of each histogram from GCN4 strains containing all WT SWI/SNF subunits or the indicated swi/snf deletion alleles (shown at the top) and from the gcn4Δ strain containing all WT SWI/SNF subunits (gcn4Δ). (See Table ​Table11 for a list of all strains employed.) High-copy-number plasmid pHQ1239 was introduced into the GCN4 strains, and empty vector YCp50 was introduced into the gcn4Δ strains. The resulting transformants were subjected to ChIP analysis as described in the legend to Fig. ​Fig.1.1. NA, not applicable; ND, not determined.

Open in a separate window

FIG. 5.

Recruitment of SWI/SNF subunits by Gcn4p to SNZ1 is impaired in snf6Δ, snf5Δ, swi3Δ, and swp73Δ mutants. The selected transformants described in the legend to Fig. ​Fig.44 were subjected to ChIP analysis to measure binding of the indicated myc-tagged SWI/SNF subunits to SNZ1 in GCN4 or gcn4Δ strains containing all WT SWI/SNF subunits (WT and gcn4Δ, respectively) and in GCN4 strains containing the indicated swi/snf deletion alleles.

Impaired recruitment of SWI/SNF in snf6Δ, snf5Δ, swi3Δ, and swp73Δ mutants likely results from complex disruption.

It was shown previously that deletions of Snf6p, Snf5p, and Swi3p affect the integrity of the SWI/SNF complex (40). Thus, the reduced recruitment of SWI/SNF subunits to ARG1 and SNZ1 we observed in snf6Δ, snf5Δ, and swi3Δ mutants and to SNZ1 in swp73Δ cells might result simply from reduced steady-state levels of these subunits in the mutant strains. To address this possibility, we conducted Western blot analysis of WCEs from swi/snf mutant and WT strains harboring SNF2-myc by using rapid extraction with trichloroacetic acid to minimize protein degradation during preparation of the extracts. The blots were probed with Myc antibodies to visualize myc-Snf2p, with antibodies against SWI/SNF subunits Snf5p and Swp73p, and with antibodies against Gcd6p to control for protein loading. Quantification of the results shown in Fig. 6A and B indicated that the steady-state levels of myc-Snf2p, Snf5p, and Swp73p (normalized for Gcd6p) were reduced by one-third or less in snf6Δ and snf5Δ cells. Greater reductions, of between 40 to 75%, were observed in swi3Δ and swp73Δ cells. (Owing to the relatively weak Western blotting signals for Swp73p, we could not estimate its reduction in swi3Δ cells.)

Open in a separate window

FIG. 6.

Western blot analysis of SWI/SNF subunits in swi/snf mutants. (A) The GCN4 strains containing SNF2-myc and either WT SWI/SNF subunits or the indicated swi/snf deletions were grown in SC-ILV, and total proteins were extracted as described in Materials and Methods. Aliqouts with equal amounts of total proteins were separated by SDS-PAGE by using 10% gels, transferred to a nitrocellulose membrane, and probed with antibodies against myc, Snf5p, or Swp73p, as indicated on the left of the blot. Probing with Gcd6p antibodies provided a loading control. The Western blotting signals were quantified by video densitometry by using NIH Image software, normalized for the Gcd6p signals, expressed relative to the normalized value measured in WT cells, and listed below the corresponding blots for myc-Snf2p, Snf5p, and Swp73p (Rel. amount). (B) The swp73Δ and swi3Δ strains exhibit similar reductions in SWI/SNF subunit levels. The analysis described for panel A was repeated for the WT, swi3Δ, swp73Δ, and snf5Δ strains harboring SNF2-myc, loading two different amounts of extract in adjacent lanes; thus, the sizes of samples in lanes 1, 3, 5, 7, and 9 were 50% of those loaded in lanes 2, 4, 6, 8, and 10.

As shown above, the Gcn4p-dependent recruitment of myc-Snf5p and myc-Swp73p to ARG1 was reduced by ~80% in snf6Δ and snf5Δ mutants (Fig. 4B and C) and recruitment of myc-Snf5p to SNZ1 was completely eliminated in the snf6Δ mutant (Fig. ​(Fig.5A).5A). These reductions in recruitment are considerably larger than the <33% decreases in expression of SWI/SNF subunits observed in snf6Δ and snf5Δ mutants (Fig. ​(Fig.6A).6A). A similar but less pronounced disparity holds for myc-Snf2p, whose recruitment to ARG1 was decreased by 50 to 65%, versus the <33% reduction in myc-Snf2p expression seen in snf6Δ and snf5Δ cells. Hence, it seemed unlikely that reduced expression alone could account for the defective recruitment of SWI/SNF subunits in snf6Δ and snf5Δ cells. The same conclusion cannot be drawn for the swi3Δ mutant, because the reductions in recruitment to ARG1 were comparable to the reductions in subunit expression for myc-Snf2p, Snf5p, and Swp73p in swi3Δ cells (compare Fig. 4A through C and 6A and B). It is noteworthy, however, that we observed comparable, strong reductions in SWI/SNF subunit expression in swi3Δ and swp73Δ cells (Fig. ​(Fig.6B),6B), yet recruitment of myc-Snf2p and myc-Snf5p to ARG1 occurred at nearly WT levels in swp73Δ cells (Fig. ​(Fig.4).4). Thus, the extensive decreases in myc-Snf2p, Snf5p, and Swp73p expression in swi3Δ cells probably cannot fully explain the dramatic reduction in recruitment of these proteins to ARG1 in the swi3Δ mutant. It appears that high-level recruitment of Snf2p and Snf5p by Gcn4p requires contributions from other SWI/SNF subunits that go beyond their roles in maintaining WT levels of Snf2p and Snf5p.

As mentioned above, previous gel filtration analysis suggested that the SWI/SNF complex is partially disrupted in snf2Δ, swi3Δ, snf5Δ, and snf6Δ strains, with a particularly strong defect in swi3Δ cells (40). We confirmed by coimmunoprecipitation analysis that the association between myc-Snf2p and Snf5p was impaired in our snf6Δ and swi3Δ strains, and we obtained the same result for the swp73Δ mutant (Fig. ​(Fig.7A).7A). By contrast, myc-Snf2p/Snf5p association was intact in snf11Δ cells, as was the myc-Swi3p/Snf5p association in snf2Δ cells (Fig. ​(Fig.7B).7B). The latter finding is in accordance with our Western blot analysis of snf2Δ cells showing high-level expression of SWI/SNF subunits (Fig. ​(Fig.6A)6A) and our ChIP data showing little or no defect in SWI/SNF recruitment in the snf2Δ mutant (Fig. 4B through F and 5A and B). To account for the previous data indicating disruption of SWI/SNF in snf2Δ cells (40), we propose that SWI/SNF is largely intact in snf2Δ cells and dissociated in vitro under the conditions of gel filtration analysis. The fact that the SWI/SNF complex is disrupted (Fig. ​(Fig.7A)7A) and subject to proteolysis (Fig. ​(Fig.6B)6B) in swp73Δ cells yet shows no defect in recruitment by Gcn4p to ARG1 could indicate that a low level of intact SWI/SNF complex remains in this strain that is sufficient for nearly WT recruitment by Gcn4p to ARG1 but inadequate for SWI/SNF recruitment to SNZ1 (Fig. 5A and B). It is also possible that SWI/SNF subcomplexes which presumably occur in swp73Δ cells can be recruited independently of one another by Gcn4p, at least to ARG1 (see Discussion).

Open in a separate window

FIG. 7.

Examination of SWI/SNF complex integrity in swi/snf mutants by coimmunoprecipitation analysis. (A) SNF2-myc strains containing WT SWI/SNF subunits or the indicated swi/snf deletions were grown in YPD, and WCEs were prepared as described in Materials and Methods. Aliqouts containing 0.3 to 0.5 mg of protein were immunoprecipitated with mouse monoclonal myc antibodies. Ten percent of the input samples (Input), 100% of the immunoprecipitates (Ppt), and 10% of the supernatant (Sup) fractions were resolved by 4 to 20% SDS-PAGE and subjected to Western blot analysis using monoclonal mouse antibodies against myc or rabbit antibodies against Snf5p. The upper and lower portions of each membrane were probed separately with different antibodies. (B) The same kind of analysis as that described for panel A was carried out by using the WT or snf2Δ strains harboring SWI3-myc.

The results presented above suggest that efficient recruitment of Snf2p and Snf5p by Gcn4p in vivo is strongly dependent on their association with other subunits in the SWI/SNF complex. If so, then overexpressing these proteins individually from high-copy-number plasmids should not increase their level of recruitment by Gcn4p. To test this prediction, we introduced a multicopy SNF2-myc plasmid, or empty vector, into the otherwise WT strain harboring SNF2-myc. Likewise, we transformed the WT SNF5-myc strain with a multicopy SNF5-myc plasmid or with vector alone. In both instances, increasing the gene dosage of SNF2-myc or SNF5-myc led to overexpression of the cognate-tagged protein (Fig. ​(Fig.8A).8A). Importantly, overexpression of myc-Snf2p led to a decrease, rather than an increase, in its recruitment to ARG1 (Fig. ​(Fig.8B,8B, compare lanes 1 and 2). Overexpression of myc-Snf5p had no impact on the amount of this protein that was recruited by Gcn4p to ARG1 (Fig. ​(Fig.8B,8B, compare lanes 6 and 7). To explain the negative effect of myc-Snf2p overexpression on its recruitment, we suggest that increasing the amount of Snf2p leads to the formation of Snf2p-containing subcomplexes that lack one or more other subunits required for efficient recruitment of SWI/SNF by Gcn4p.

Open in a separate window

FIG. 8.

Overexpression of myc-Snf2p or myc-Snf5p does not increase their recruitment to ARG1. (A) The SNF2-myc (SY1), SNF5-myc (SY162), and snf6Δ SNF2-myc (SY3) strains described in the legends to Fig. ​Fig.11 and ​and44 were transformed with high-copy-number plasmid pSY286 or pSY287, harboring SNF2-myc or SNF5-myc, respectively, or with empty vector YCp50 and subjected to Western blot analysis as described in the legend to Fig. ​Fig.6.6. Lanes 1 through 3, SNF2-myc strain transformed with the plasmids indicated at the top; lanes 4 and 5, snf6Δ SNF2-myc strain transformed with pSY286; lanes 6 through 8, SNF5-myc strain transformed with the plasmids indicated at the top. The samples in lanes 2, 5, and 7 contained 50% of those loaded in lanes 1, 4, and 6, respectively. (B) ChIP analysis was performed on the transformants described for panel A. Lanes 1 through 4, transformants of the SNF2-myc and snf6Δ SNF2-myc strains harboring the plasmids indicated at the top; lanes 6 and 7, transformants of the SNF5-myc strain harboring the plasmids indicated at the top; lane 5, transformant of the gcn4Δ SNF2-myc strain containing YCp50.

The multicopy SNF2-myc plasmid also led to greater-than-WT levels of myc-Snf2p in the snf6Δ mutant, compensating for the slight effect of this mutation on myc-Snf2p expression (Fig. ​(Fig.8A,8A, compare lanes 3 through 5). Nonetheless, the recruitment of myc-Snf2p was impaired in this transformant relative to that seen in the WT strain with native levels of myc-Snf2p (Fig. ​(Fig.8B,8B, compare lanes 2 and 3). We found by coimmunoprecipitation analysis that overexpressing myc-Snf2p in the snf6Δ mutant slightly increased SWI/SNF complex formation (data not shown), most likely accounting for the small increase in myc-Snf2p recruitment observed in this situation (Fig. ​(Fig.8B,8B, compare lanes 3 and 4). The results shown in Fig. ​Fig.88 support our conclusion that Snf6p contributes to SWI/SNF recruitment in a manner that exceeds its contribution to SWI/SNF subunit expression, presumably by promoting SWI/SNF complex integrity (see Discussion).

Snf2p is dispensable, but Snf5p, Snf6p, and Swi3p are required for optimal recruitment of SWI/SNF by Gcn4p.

Our results also illuminate several aspects of the mechanism of SWI/SNF recruitment by Gcn4p. Because Snf2p, Snf5p, and Swi1p interact with the Gcn4p activation domain in vitro (37), we sought to determine whether these subunits are necessary or sufficient for recruitment of native SWI/SNF by Gcn4p in vivo. We found that deletion of SNF2 did not significantly reduce the recruitment of other SWI/SNF subunits by Gcn4p to ARG1 and SNZ1. (We verified the absence of both SNF2 coding sequences and immunologically detectable Snf2p in the snf2Δ strain.) Additionally, the excess Snf2p present in a strain overexpressing this subunit alone was not recruited to ARG1, suggesting that Snf2p cannot be recruited directly by Gcn4p in vivo. In contrast to these results, deletion of SNF5 decreased Gcn4p-dependent recruitment of other SWI/SNF subunits to ARG1 by 50 to 80%, with an average reduction of 70%. Moreover, deletion of SNF5 severely impaired SWI/SNF recruitment to SNZ1, lowering the binding of myc-Snf6p and myc-Swi1p to the same low level observed in gcn4Δ cells. These recruitment defects are substantially greater than the ~15% reductions in subunit expression we observed in snf5Δ cells, suggesting that Snf5p makes a contribution to SWI/SNF recruitment beyond its role in maintaining WT levels of SWI/SNF subunits.

One way to account for the role of Snf5p in SWI/SNF recruitment is to propose that Snf5p is a direct target of Gcn4p (37). However, we found that Snf5p cannot be efficiently recruited by Gcn4p in a snf6Δ mutant, in which Snf5p expression is only slightly reduced, and that excess Snf5p produced in WT cells was not recruited by Gcn4p. To explain these findings, we propose that the Gcn4p-Snf5p interaction is only one of several contacts between Gcn4p and the SWI/SNF complex and that this interaction is not strong enough to support recruitment of Snf5p outside of intact SWI/SNF. Because SWI/SNF is disrupted in the snf6Δ mutant, Gcn4p cannot interact simultaneously with Snf5p and other targets in the complex, such as Snf2p or Swi1p, leading to defective recruitment of Snf5p in the snf6Δ strain. Similarly, deletion of SNF5 disrupts the complex and prevents concerted interaction of Gcn4p with multiple other subunits in addition to abolishing the contact with Snf5p.

Ostensibly at odds with the idea that complex integrity is required for SWI/SNF recruitment by Gcn4p, the swp73Δ mutation did not impair the recruitment of SWI/SNF to ARG1, even though it disrupted interaction between myc-Snf2p and Snf5p, as indicated by coimmunoprecipitation experiments. However, swp73Δ did reduce the recruitment of SWI/SNF to SNZ1. One way to explain these findings is to propose that a low level of the SWI/SNF complex lacking only Swp73p persists in swp73Δ cells and is recruited efficiently by Gcn4p to ARG1 because it contains multiple contact sites for Gcn4p. Indeed, a low level of myc-Snf2p/Snf5p association was detected in the swp73Δ extracts in our coimmunoprecipitation assays. By contrast, low levels of otherwise intact SWI/SNF complexes lacking only Snf5p, Snf6p, or Swi3p may not exist in snf5Δ, snf6Δ, or swi3Δ mutants. The inability of Gcn4p to recruit the putative SWI/SNF complex lacking only Swp73p to SNZ1 in swp73Δ cells may be related to the fact that binding of Myc-Gcn4p and recruitment of WT SWI/SNF to SNZ1 occurs at only one-fourth or one-third, respectively, of the levels seen at ARG1. SAGA and SRB mediator are also recruited at lower levels to SNZ1 than to ARG1 (data not shown). Thus, the low concentration of intact SWI/SNF complexes in swp73Δ cells may be insufficient for their recruitment to SNZ1 because of reduced levels of Gcn4p and other coactivators bound at the promoter.

Another way to account for the recruitment of SWI/SNF subunits to ARG1 in swp73Δ cells would be to propose that particular subcomplexes remaining in swp73Δ cells retain sufficient contacts with Gcn4p to support their recruitment to ARG1 but not to SNZ1. By contrast, the snf5Δ, snf6Δ, and swi3Δ mutations would produce different, more defective subcomplexes containing too few contacts for Gcn4p. The latter suggestion is consistent with the fact that Snf5p and Swi3p belong to the evolutionarily conserved core of the SWI/SNF complex (42) and that Swi3p and Snf6p are the only two subunits present in two copies per complex (48). Hence, Snf5p, Snf6p, and Swi3p may play greater roles than Swp73p in linking together multiple subunits of the SWI/SNF complex.

Our finding that Snf2p is dispensable for SWI/SNF recruitment by Gcn4p differs from results described recently for SWI/SNF binding at the SUC2 and SER3 promoters. At SER3, Snf2p functions in repression in a manner largely independent of other SWI/SNF subunits. In this instance, Snf2p was crucial for Snf5p binding at SER3, whereas Snf5p was dispensable for Snf2p binding to the promoter (33). Thus, the relative importance of Snf2p and Snf5p for recruitment seems to be reversed between SER3 and ARG1/SNZ1. It is unknown whether Snf2p is actively recruited to SER3; perhaps it binds directly to acetylated histone tails through its bromodomain (17). At SUC2, it was found that Snf2p and Snf5p are mutually interdependent for promoter binding, and it was concluded there, as in our study, that an intact complex is crucial for recruitment of SWI/SNF to this promoter (13). It remains possible that the optimal rate of SWI/SNF recruitment by Gcn4p is dependent on Snf2p, even if the final extent of binding is not significantly impaired in snf2Δ cells. It was conceivable that Snf2p would be required for efficient SWI/SNF recruitment at lower levels of promoter occupancy by Gcn4p than were examined in our experiments; however, we found recently that deleting SNF2 does not decrease SWI/SNF recruitment to ARG1 in cells expressing native levels of Gcn4p (data not shown).

We thank Fan Zhang for advice on experimental protocols. We are grateful to Brehon Laurent, Brad Cairns, and Joe Reese for generous gifts of antibodies. We thank Hans Hwang, Soon-ja Kim, and members of the Hinnebusch and Dever Laboratories for helpful suggestions during the course of this work.