Europe PMC

This website requires cookies, and the limited processing of your personal data in order to function. By using the site you are agreeing to this as outlined in our privacy notice and cookie policy.

Proteomic Analysis Reveals Branch-specific Regulation of the Unfolded Protein Response by Nonsense-mediated mRNA Decay.

Author information

Affiliations

  • 1. From the ‡Molecular Medicine Partnership Unit, European Molecular Biology Laboratory, University of Heidelberg, Heidelberg, Germany; §Department of Pediatric Oncology, Hematology and Immunology, University of Heidelberg, Heidelberg, Germany;
      Authors
    • Sieber J 1
    • Bhuvanagiri M 1
    • Neu-Yilik G 1
    • Kulozik AE 1
    (4 authors)
  • 2. From the ‡Molecular Medicine Partnership Unit, European Molecular Biology Laboratory, University of Heidelberg, Heidelberg, Germany; §Department of Pediatric Oncology, Hematology and Immunology, University of Heidelberg, Heidelberg, Germany; ¶European Molecular Biology Laboratory, Heidelberg, Germany.
      Authors
    • Hauer C 2
    (1 author)
  • 3. ¶European Molecular Biology Laboratory, Heidelberg, Germany.
      Authors
    • Leicht S 3
    • Krijgsveld J 3
    (2 authors)
  • 4. From the ‡Molecular Medicine Partnership Unit, European Molecular Biology Laboratory, University of Heidelberg, Heidelberg, Germany; ¶European Molecular Biology Laboratory, Heidelberg, Germany.
      Authors
    • Hentze MW 4
    (1 author)

ORCIDs linked to this article

Molecular & Cellular Proteomics : MCP, 20 Feb 2016, 15(5):1584-1597
https://doi.org/10.1074/mcp.m115.054056 PMID: 26896796 PMCID: PMC4858941

Free full text in Europe PMC

Abstract 

Nonsense-mediated mRNA decay (NMD) has originally been described as a surveillance mechanism to inhibit the expression of mRNAs with truncated open reading frames (ORFs) and to contribute to the fidelity of gene expression. It is now recognized that NMD also controls the expression of physiological genes with "intact" mRNA. Stress can decrease NMD efficiency and thus increase the mRNA levels of physiological NMD targets. As stress can also inhibit translation, the net outcome for shaping the proteome is difficult to predict. We have thus analyzed de novo protein synthesis in response to NMD inhibition or the induction of mild endoplasmic reticulum (ER) stress by treatment of cells with the reducing agent dithiotreitol (DTT). For this purpose, we combined pulsed azidohomoalanine (AHA) and stable isotope labeling by amino acids in cell culture (SILAC). Labeled proteins were purified by click chemistry-based covalent coupling to agarose beads, trypsinized, fractionated, and analyzed by mass spectrometry (MS). We find that mild ER stress up-regulates the de novo synthesis of components of all three branches of the unfolded protein response (PERK, IRE1 and ATF6) without increasing eIF2α phosphorylation or impairing of protein translation. In contrast, inhibition of NMD induces de novo protein synthesis of downstream targets of the PERK and IRE1 pathways, whereas we could not detect regulation of ATF6-responsive genes. These data thus support a model that implicates a positive feedback loop of ER stress inhibiting NMD efficiency which further promotes the ER stress response in a branch-specific manner.

Free full text 

Logo of mcpMolecular & Cellular Proteomics : MCP
Mol Cell Proteomics. 2016 May; 15(5): 1584–1597.
Published online 2016 Feb 20. https://doi.org/10.1074/mcp.M115.054056
PMCID: PMC4858941
PMID: 26896796

Proteomic Analysis Reveals Branch-specific Regulation of the Unfolded Protein Response by Nonsense-mediated mRNA Decay* An external file that holds a picture, illustration, etc. Object name is sbox.jpg

Jana Sieber,‡§ Christian Hauer,‡§ Madhuri Bhuvanagiri,‡§ Stefan Leicht, Jeroen Krijgsveld, Gabriele Neu-Yilik,‡§ Matthias W. Hentze,‡ and Andreas E. Kulozik‡§‖
Author information Article notes Copyright and License information Disclaimer

Abstract

Nonsense-mediated mRNA decay (NMD) has originally been described as a surveillance mechanism to inhibit the expression of mRNAs with truncated open reading frames (ORFs) and to contribute to the fidelity of gene expression. It is now recognized that NMD also controls the expression of physiological genes with “intact” mRNA. Stress can decrease NMD efficiency and thus increase the mRNA levels of physiological NMD targets. As stress can also inhibit translation, the net outcome for shaping the proteome is difficult to predict. We have thus analyzed de novo protein synthesis in response to NMD inhibition or the induction of mild endoplasmic reticulum (ER) stress by treatment of cells with the reducing agent dithiotreitol (DTT). For this purpose, we combined pulsed azidohomoalanine (AHA) and stable isotope labeling by amino acids in cell culture (SILAC). Labeled proteins were purified by click chemistry-based covalent coupling to agarose beads, trypsinized, fractionated, and analyzed by mass spectrometry (MS). We find that mild ER stress up-regulates the de novo synthesis of components of all three branches of the unfolded protein response (PERK, IRE1 and ATF6) without increasing eIF2α phosphorylation or impairing of protein translation. In contrast, inhibition of NMD induces de novo protein synthesis of downstream targets of the PERK and IRE1 pathways, whereas we could not detect regulation of ATF6-responsive genes. These data thus support a model that implicates a positive feedback loop of ER stress inhibiting NMD efficiency which further promotes the ER stress response in a branch-specific manner.

Data are available via ProteomeXchange with identifier PXD002648.

Nonsense-mediated mRNA decay (NMD)1 is the major surveillance mechanism of the cell to recognize and degrade faulty mRNA molecules. NMD is translation- and splicing-dependent, and activated by a premature termination codon (PTC) that can be introduced into mRNAs by DNA mutations or RNA processing defects (1, 2). The translation of such transcripts that may otherwise cause the biosynthesis of truncated and potentially harmful proteins in the cell is thus limited (3). PTCs are recognized during translational termination by the “SURF” complex. This complex consists of the essential NMD factor UPF1, its kinase SMG1 as well as the eukaryotic release factors eRF1 and eRF3 and interacts with the exon-junction complex (EJC). If the EJC resides at least 50 nucleotides downstream of the PTC (4), phosphorylation of UPF1 by SMG1 will trigger a sequence of events that will ultimately lead to fast decay of the mRNA molecule (5). In addition, NMD can also be activated by a very long 3′UTR, even in the absence of 3′UTR introns and downstream EJCs (6, 7).

Previous studies have shown that many physiological mRNAs are regulated by NMD in addition to PTC-containing transcripts (8–14). Interestingly, many of these genes are involved in stress response pathways, such as amino acid homeostasis (9) and the integrated stress response following hypoxia or endoplasmic reticulum (ER) stress (15–19). In addition to its surveillance function, NMD might therefore play a regulative role in these signaling pathways.

When misfolded proteins accumulate in the ER they are bound by the molecular chaperone bone-inducing protein (BiP/GRP78/HSPA5), thus preventing harmful protein aggregation and activating the unfolded protein response (UPR). One consequence is the transactivation of the three UPR key regulators, the ER transmembrane proteins PERK, IRE1 and ATF6 which are bound and inactivated by BiP under normal conditions. PERK is a kinase that phosphorylates eIF2α, and as a consequence, reduces the global protein translation rate (20). In addition, phosphorylated eIF2α specifically activates the translation of the transcription factor ATF4 (21). IRE1 is activated in a similar manner as PERK, i.e. by release from BiP, dimerization and autophosphorylation. However, IRE1 activates the transcription factor XBP-1 by an unusual cytoplasmic cleavage and splicing event (22). The third branch of the UPR is mediated by ATF6 which translocates to the Golgi after release from BiP where it is cleaved. The cytoplasmic part of ATF6 is a transcription factor that migrates to the nucleus and activates the transcription of downstream targets such as XBP-1, BiP, and other chaperones (23, 24).

Of note, NMD itself is down-regulated by hypoxia or ER stress (15–18). The exact mechanisms of this regulation remain unknown, although previous data suggest a role of eIF2α phosphorylation (15). However, because NMD is itself translation-dependent, this response may also result from the less efficient protein translation of a stressed cell.

It is an important question, therefore, whether regulated NMD plays a major role in shaping the proteome under conditions of stress and how NMD may thus contribute to the stress response. Although it has been shown that some NMD target mRNAs can be translated into functional proteins (25–28), global data addressing the translation of NMD target mRNAs are still missing. Here, we have monitored the expression of global de novo protein synthesis following NMD inhibition and stress induction to determine the contribution of NMD on the cellular stress response.

MATERIALS AND METHODS

Experimental Design and Statistical Rationale

The pulsed azidohomoalanine (AHA) and stable isotope labeling by amino acids in cell culture (SILAC) experiments were carried out in biological duplicates. The same negative control cells were used for the normalization of the UPF1 depletion and the ER stress induction. HeLa cells were cultured as separate batches for 4 passages until the experiment was performed. Each batch served as biological duplicate. For the experiment, two plates of each batch were transfected with control siRNA and one plate was transfected with siRNA against UPF1. During the labeling time, the cells of one of the two control siRNA-transfected plates were incubated with (dithiothreitol) DTT, the other one with the equivalent volume of solvent (H2O). In this way, the H2O-incubated, control siRNA-transfected plates could serve as negative control for both treatments and enabled better comparability. SILAC labels were reversed in biological duplicates. Statistical analyses were performed using the Limma package in R/Bioconductor (29, 30). After fitting a linear model to the data, an empirical Bayes moderated t test was used, and p values were adjusted for multiple testing with the Benjamini-Hochberg method. For all other experiments two to six independent biological replicates were assayed and statistical analysis was performed as indicated in the figure legends.

Cell culture, Transfections, and Treatments

Stable HeLa cells constitutively expressing the NMD reporter construct Renilla-HBB NS39 (25) from a single copy integration site were cultured in complete DMEM ((Gibco/Thermo Fisher Scientific, Carlsbad, CA), supplemented with 10% fetal calf serum (FCS) and 1% Penicillin/Streptavidin (P/S)) with 150 μg/ml Hygromycin B to maintain the stably transfected NMD reporter. Hygromycin B was omitted in experiments. For DTT treatment, cells were seeded at 2 × 105 cells/well into six-well plates. For analysis of the ATF4 and ATF6 response elements 1.3 × 105 HeLa cells/well were seeded in 6-cm dishes and transfected with 40 pmol of either siUPF1 or AllStars control siRNA (Qiagen, Hilden, German). Two days later cells were again transfected with 40 pmol siRNA and with 650 ng of the reporter plasmid pGL4.39[luc2P/ATF6-RE/Hygro] or pGL4[luc2P/ATF4-RE/Hygro] (Promega, Madison, WI), 100 ng of pCI-neo-Renilla as normalization control and 100 ng of pCI-neo-YFP as transfection control using jetPRIME™ (Polyplus, Illkirch, France) according to the manufacturer's protocol. The next day, cells were treated with 1.5 mm DTT or H2O for 6 h. For the pulsed SILAC experiment cells were divided into two batches at passage 6 (P6) and kept separately for the remaining experiment as biological duplicates. At P10 1.2 × 107 cells were seeded into 15-cm dishes. The next day cells were transfected with 300 pmol of either siUPF1 or siLuc (31) and 46 μl Oligofectamine (Life Technology Invitrogen/Thermo Fisher Scientific, Carlsbad, CA) in 15 ml Opti-MEM (Gibco/Thermo Fisher Scientific, Carlsbad, CA) free of serum and antibiotics. After 4 h 15 ml DMEM containing 20% FCS and 2% P/S was added. The next day, cells from one 15 cm dish were split into 10-cm dishes at a density of 2 × 106 cells/dish and kept in DMEM containing 10% FCS and 1% P/S.

Pulse Labeling of Cells with AHA and SILAC

Two days after siRNA transfection cells were washed twice with PBS and pre-incubated in DMEM free of methionine, arginine and lysine, and containing 10% dialyzed FCS (Sigma, Munich, Germany) and 1% l-glutamine for 30 min to deplete them of methionine, arginine and lysine. Then the medium was replaced by SILAC medium containing 0.1 mm l-AHA (AnaSpec, Inc., Fremont, CA) and either 84 μg/ml [13C6,15N4] l-arginine and 146 μg/ml [13C6,15N2]l-lysine (heavy) or 84 μg/ml [13C6]l-arginine and 146 μg/ml [4,4,5,5-D4]l-lysine (intermediate) (Cambridge Isotope Laboratories, Inc., Tewksbury, MA), and 1.5 mm DTT or H2O. Labels were reversed in biological duplicates. After 6 h cells were washed in PBS, put on ice and scraped into ice-cold PBS. 20% of the cells were lysed in RLT buffer (Qiagen RNeasy Mini) for RNA extraction and stored at −80 °C. 2% of the cells were taken for measurements of luciferase activity. These and the remaining cells for the pulsed SILAC (pSILAC) analysis were frozen separately as dry cell pellets.

Enrichment of Newly Synthesized Proteins and On-bead Digestion

Newly synthesized proteins were enriched using the Click-iT Protein Enrichment Kit (Invitrogen C10416) applying the vendor's protocol with slight modifications as described before (32). Briefly, after washing 100 μl agarose resin slurry with 900 μl water, the protein extract was diluted in 250 μl urea buffer, and catalyst solution were incubated for 16–20 h at room temperature. The resin was washed with 900 μl water, 0.5 ml SDS buffer and 0.5 μl 1 m DTT at 70 °C for 15 min. After removing the supernatant 3.7 mg iodoacetamide (Bio-Rad) was added and incubated for 30 min. Then the resin was washed with 20 ml of SDS buffer, 20 ml of 8 m urea in 100 mm Tris, pH 8, 20 ml of 20% isopropanol and 20 ml of 20% acetonitrile, followed by proteolysis by 0.5 μg trypsin (Promega) in digestion buffer (100 mm Tris, pH 8, 2 mm CaCl2 and 10% acetonitrile).

Peptide Fractionation by High-pH Reversed Phase Chromatography

Peptide fractionation was performed via High pH reversed-phase chromatography on an Agilent 1260 HPLC system using an XBridge BEH C18 column (1 × 100 mm, 3.5 μm, 130 Å, Waters, Milford, MA). Elution was performed at a flow rate of 0.1 ml/min using a gradient of mobile phase A (20 mm ammonium formate, pH 10) and B (acetonitrile), from 1% to 37.5% over 61 min. Fractions were collected every 2 min across the entire gradient length and concatenated into 10 final samples as discussed previously (33). Fractions were dried in a SpeedVac centrifuge and reconstituted in 0.1% formic acid prior to mass spectrometry (MS) analysis.

Liquid-chromatography Tandem Mass Spectrometry (LC-MS/MS)

Peptides were separated using a nanoAcquity UPLC system (Waters) fitted with a trapping (nanoAcquity Symmetry C18, 5 μm, 180 μm × 20 mm) and an analytical column (nanoAcquity BEH C18, 1.7 μm, 75 μm × 200 mm). The outlet of the analytical column was coupled directly to a linear trap quadrupole (LTQ) OrbitrapVelos or OrbitrapVelos Pro (Thermo Fisher Scientific) using a Proxeon nanospray source. The samples were loaded with a constant flow of solvent A (0.1% formic acid) at 15 μl/min and were eluted at a constant flow of 0.3 μl/min. During the elution step, the percentage of solvent B (0.1% formic acid in acetonitrile) increased in a linear fashion from 3% to 25% in 110 min, followed by an increase to 40% in 4 min, and an increase to 85% in 1 min. The peptides were introduced into the mass spectrometer by a Pico-Tip Emitter 360 μm OD × 20 μm ID; 10 μm tip (New Objective, Woburn, MA). Full scan mass spectrometry spectra with mass range 300–1700 mass-to-charge ratio (m/z) were acquired in profile mode in the orbitrap with a resolution of 30,000. The filling time was set at maximum of 500 ms with a limitation of 10 million ions. The most intense ions (up to 15) were selected for fragmentation in the ion trap. A normalized collision energy of 40% was used, and the fragmentation was performed after accumulation of 3 × 104 ions or after a filling time of 100 ms for each precursor ion (whichever occurred first). Only multiply charged (2+ or 3+) precursor ions were selected for MS/MS. The dynamic exclusion list was restricted to 500 entries, with a maximum retention period of 30 s and a relative mass window of 10 p.p.m. Lock mass correction using a background ion (m/z 445.12003) was applied.

Data Processing

The raw data were processed using MaxQuant (version 1.3.0.5) (34), and MS/MS spectra were searched using the Andromeda search engine (35) against human proteins in UniProt (69,906 entries, downloaded March, 01, 2013 (36). Enzyme specificity was set to trypsin/P, and a maximum of two missed cleavages was allowed. Cysteine carbamidomethylation was used as the fixed modification and methionine oxidation, protein N-terminal acetylation and replacement of methionine by AHA were used as variable modifications. The minimal peptide length was set to 6 amino acids. The initial maximal allowed mass tolerance was set to 20 p.p.m. for peptide masses and then was set to 6 p.p.m. in the main search and to 0.5 Da for fragment ion masses. False discovery rates (FDRs) for peptide and protein identification were set to 0.01. At least one unique peptide was required for protein identification. The protein identification was reported as an indistinguishable “protein group” if no unique peptide sequence to a single database entry was identified.

For protein quantification, a minimum of two ratio counts was set and the “Requantify” and “match between runs” functions were enabled. Average protein ratios were reported if they could be quantified in both replicates each on the basis of at least two ratio counts. Spectra of quantified single peptide identifications are published as supplementary files (Single Peptides Spectra).

Biostatistical Analysis of Proteomics Data

Statistical analyses were performed using the Limma package in R/Bioconductor (29, 30). After fitting a linear model to the data, an empirical Bayes moderated t test was used, and p values were FDR-adjusted for multiple testing with the Benjamini-Hochberg method. If not stated otherwise, proteins with an FDR < 0.05 were considered to be differentially expressed. Prior to statistical tests of the DTT data set, values with high variation between replicates were removed if the difference of the log2-fold change between the biological replicates was greater than the 10-fold average standard deviation of 0.245. For the siUPF1 depletion data set, we considered all quantified proteins.

Correlations between replicates were calculated in R using Pearson correlation. Heatmaps were created in R/Bioconductor using the pheatmap package. 3′UTR length analysis of the principal transcripts was done manually using Ensembl database, assembly GRCh38.p2 (37).

Gene ontology enrichment analysis was performed using AmiGO 1.8 and the GO database (release date 2015–01-11, www.geneontology.org).

Quantitative RNA Analysis

RNA was isolated using the RNeasy Mini Kit from Qiagen. 500 ng total RNA were reverse transcribed following manufacturer's instructions for RevertAid H minus reverse transcriptase (Thermo Scientific) using oligo-dT primers. The RT-PCR was performed on a StepOnePlus™ machine (Applied Biosystems/Thermo Scientific, Foster City, CA), using Absolute™ SYBR green mix (Thermo scientific, AB-1185). The primers used in this study were:

  • SC35C: GGCGTGTATTGGACCAGATGTA/CTGCTACACAACTGCGCCTTTT

  • PTGS2: ATCACAGGCTTCCATTGACC/CAGGATACAGCTCCACAGCA

  • TGM2: GGGTGAGAGAGGAAAGACC/TGCAGTCTAGGGAGCTGGAT

  • RPL3: GGCATTGTGGGCTACGTG/CTTCAGGAGCAGAGCAGA

  • UPF1: TGCACACCAAGCTCTACCAG/TGACGCCATACCTTGCTCTG

  • RPL13: CTCTCAAGGTGTTTGACGGC/TTTATTGGGCTCAGACCAGG

Luciferase Assay and Western blotting

For analysis of Renilla luciferase activity cell pellets were lysed in Passive Lysis Buffer (Promega). Dual-Luciferase assay (Promega) was performed according to manufacturer's instructions to analyze the activity of the firefly Luc2p reporter gene. For Western blot analysis cells were either lysed in RIPA buffer containing Protease Inhibitor Mixture cOmplete (Roche Diagnostics, Mannheim, Germany) or directly in 2× SDS sample buffer (for phospho-eIF2α detection). Ten to twenty micrograms of total lysate were separated by SDS-PAGE and transferred onto PVDF membranes. After blocking in 5% milk or BSA, membranes were probed with antibodies against hUPF1 (Bethyl Laboratories, Montgomery, TX, A300–036A), BiP (Cell Sigaling Technology, Danvers, MA, #3177), eIF2α (Cell Signaling, #2103), phospho-eIF2α (Cell Signaling, #3398), tubulin (Sigma, T5168) or actin (Sigma, A1978).

Analysis of Global Protein Translation by Metabolic Labeling

HeLa cells were seeded in six-well plates at 2 × 105 cells per well and kept in complete DMEM. The next day, cells were treated with either DTT or cycloheximide (CHX) for 5.5 h. Then, complete DMEM was replaced with depletion medium (DMEM without methionine and cysteine, 10% dialyzed FCS, 1% l-glutamine, DTT or CHX) for 30 min to deplete cells of internal stores of methionine and cysteine. Newly translated proteins were then labeled for 30 min with 35S Easy Tag Express (20 μCi/ml, Perkin Elmber, Waltham, MA) in the presence of DTT or CHX (full treatment time 6.5 h). Cells were washed twice in PBS, lysed in ice-cold RIPA buffer and centrifuged at 16,000 × g, 4 °C. For quantification of 35S incorporation 10 μl supernatant were spotted onto a glass microfiber filter (Whatman, Little Chalfont, UK) and dried. Proteins were precipitated with ice-cold 15% TCA for 30 min, washed once with ice-cold 15% TCA and twice with ice-cold 100% ethanol, and dried. Radioactivity was then determined by scintillation counting. Scintillation counts were normalized with protein concentration. For autoradiography analysis, 10 μg of lysate were separated on a 12% SDS gel and radioactive signals were quantified by phosphor imaging in a FLA-3000 fluorescent image analyzer (Raytest, Straubenhardt, Germany). Coomassie stained gels were used as loading controls.

RESULTS

Analysis of Newly Synthesized Proteins by Combined Pulsed SILAC and Click-chemistry Enrichment

To identify proteins that are up-regulated during inhibition of NMD by ER stress or by UPF1 depletion, we enriched de novo synthesized proteins by pulse-labeling with the methionine analogue AHA in combination with pSILAC (32, 38). We induced ER stress by low dose DTT treatment (1.5 mm) for 6 h (Fig. 1A). Under these mild stress conditions, overall protein translation was compromised by only 20%, comparable to the effect of low dose treatment with cycloheximide (1 μg/ml, Fig. 1B and ​and11C). This treatment elicited a cellular stress response with overexpression of BiP and activation of an ATF6-responsive promoter (Fig. 1D and ​and11E). Although eIF2α was phosphorylated after treatment with 100 μm arsenite and higher dosages of DTT, phosphorylation of eIF2α was below the detection limit after incubation with 1.5 mm DTT (Fig. 1D), indicating the induction of weak ER stress without eIF2α-dependent inhibition of translation.

An external file that holds a picture, illustration, etc. Object name is zjw0051653070001.jpg

Low dose of DTT induces ER stress, but only mildly inhibits protein translation. A, Experimental overview of the metabolic labeling experiments to analyze protein translation efficiency. B, Quantification of 35S incorporation after 6 h of DTT or CHX treatment. Cellular lysate was spotted onto glass fiber membranes, dried, precipitated with 15% TCA and 35S incorporation was quantified by scintillation counting and normalized to the total protein concentration. Bars represent mean ± S.D. Statistical analysis was done by one-sample, two-tailed t test (* = p < 0.05, ** = p < 0.01, *** = p < 0.001, **** = p < 0.0001). n = 6 (DTT treatment), n = 4 (CHX treatment, 0 - 5 μg/ml), n = 2 (CHX treatment, 10 and 50 μg/ml). C, Representative autoradiograph of 35S-labeled proteins and the Coomassie stain of the same gel. D, Phosphorylation of eIF2α and induction of BiP after DTT and arsenite treatment for 6 h was analyzed by Western blotting. E, Induction of the ATF6-responsive element (ATF6-RE) after DTT incubation. HeLa cells were transfected with a reporter plasmid containing the ATF6-RE fused to a firefly luciferase open reading frame and treated with DTT for 6 h. Expression of firefly was assessed by a luciferase assay. F, NMD reporter construct to monitor NMD efficiency. The open reading frame of Renilla luciferase (white) is fused in frame to a human β-globin (HBB) minigene (dark gray) bearing a nonsense mutation on position 39 (NS39). Ter depicts the natural termination codon of HBB. The expression of the reporter construct is controlled by a CMV promoter (light gray). G, Depletion of UPF1 or ER stress causes inhibition of NMD. HeLa cells stably expressing an NMD reporter construct (Renilla-HBB NS39) were transfected with siUPF1 or a control siRNA. In addition one of the two siCtrl-transfected wells was treated with 1.5 mm DTT. After 6 h cells were harvested and the expression of Renilla-HBB NS39 was measured by luciferase assay. Bars show mean of n = 4, ± S.D.

To monitor the efficiency of NMD in the cell we made use of a previously established reporter system consisting of Renilla luciferase fused to a human β-globin mini gene with a PTC at position 39 (HBB NS39, Fig. 1F) (25). This construct is constitutively expressed from a single copy integration in our HeLa cell line. Under normal conditions NMD is highly active and efficiently degrades the reporter mRNA. If NMD efficiency is impaired the reporter mRNA becomes stabilized, enriched, and translated, resulting in a measurable increase of Renilla luciferase activity (Fig. 1G). DTT treatment robustly inhibited NMD and increased activity of the Renilla-HBB NS39 NMD reporter ~fourfold, whereas UPF1 depletion caused a twofold up-regulation (Fig. 1F). As a twofold increase can be detected by mass spectrometry (32), our experimental system was thus sufficiently sensitive to monitor the up-regulation of putative NMD target proteins.

Identification of De Novo Synthesized UPF1 Target Proteins

To monitor NMD targets, we transfected HeLa cells stably expressing the NMD reporter construct together with UPF1 siRNA or control siRNA. Two days after transfection DMEM was replaced with methionine-, arginine-, and lysine-free DMEM, and cells were starved for these amino acids for 30 min. Cells were then incubated with AHA, isotope-labeled arginine and lysine and 1.5 mm DTT or H2O, and harvested after 6 h of incubation. Isotope labels were switched in biological duplicates. Newly synthesized proteins containing AHA were covalently bound to alkyne-coupled agarose beads by a click reaction, and then washed and trypsinized. Peptides were fractionated to reduce sample complexity and subjected to LC-MS/MS (Fig. 2).

An external file that holds a picture, illustration, etc. Object name is zjw0051653070002.jpg

Analysis of newly synthesized proteins by combined pulsed SILAC and click chemistry enrichment. Experimental setup for the identification of proteins which are synthesized during depletion of UPF1. Pulse-labeling of cells with both the methionine analogue AHA and stable isotopes for 6 h allowed the enrichment of these proteins by click chemistry, on-bead trypsin digestion, fractionation of peptides and subsequent identification and quantification by LC-MS/MS (modified after (32)).

Expression analysis of the NMD reporter by luciferase assay and by monitoring the mRNA abundance of known endogenous NMD target mRNAs confirmed efficient inhibition of NMD (Fig. 3A, ​,33B). In total, we identified 7016 proteins, 4900 of which were reliably quantified in both biological replicates; expression changes were normally distributed (Fig. 3C and ​and33D, supplemental Table S1). We selected 511 proteins that displayed a significant differential expression (FDR < 0.05) with modest but significant expression changes (1.3 to 3.2-fold). As expected, UPF1 is the most downregulated protein with 27% expression compared with control cells (Fig. 3C).

An external file that holds a picture, illustration, etc. Object name is zjw0051653070003.jpg

Identification of de novo synthesized UPF1 target proteins. HeLa cells stably expressing the NMD reporter Renilla-HBB NS39 were transfected with UPF1 siRNA or a control siRNA. Two days after transfection DMEM was replaced with methionine, arginine and lysine-free DMEM containing AHA and isotope-labeled arginine and lysine. Isotope labels were reversed in biological duplicates. Cells were harvested after 6 h of incubation. NMD inhibition was controlled by expression analysis of the NMD reporter and known endogenous NMD targets. The remaining cell lysate was used for enrichment of de novo synthesized proteins and subsequent analysis by LC-MS/MS. A, Luciferase assay reveals a twofold up-regulation of Renilla-HBB NS39 on protein level upon UPF1 depletion. B, RT-qPCR analysis of endogenous NMD target RNAs. RPL13A serves a non-NMD target control. UPF1 mRNA was downregulated to 40% by siUPF1. C, 4898 proteins were identified and quantified in two biological replicates. Proteins that were regulated with statistical significance (FDR < 0.05) are shown in red. UPF1 is the most downregulated protein (down to 27%). R = Pearson correlation coefficient. D, Distribution of the average change of expression after UPF1 depletion.

Known NMD Target mRNAs are Translated into Protein After NMD Inhibition

We decided to downregulate UPF1 because several independent studies previously have identified endogenous UPF1 target transcripts (“physiological NMD target mRNAs”) by whole transcriptome analysis (9, 11, 12, 14). We compared our list of 511 significantly regulated proteins with the results of these studies and found 140 proteins to overlap with regulated RNAs detected in one or more of these published data sets (27.4%, supplemental Fig. S1). Eighty of these shared candidates show an increase and 60 show a decrease of expression in our proteomics analyses, and in 90% of cases the direction of the protein expression change corresponds to the changes in RNA expression. At the RNA level, 46 of these genes also show regulation in at least 2 out of the 4 previously reported RNA analyses (Fig. 4A).

An external file that holds a picture, illustration, etc. Object name is zjw0051653070004.jpg

High correlation of expression changes of NMD-regulated genes identified by both the pSILAC screen and previously reported global RNA screens after UPF1 depletion. A, Heatmap comparing the log2-fold change of expression of UPF1 targets on protein (pSILAC) or RNA level (9, 11, 12, 14). Only genes are shown that have been identified in the pSILAC screen and at least 2 RNA screens. B–E, Candidate genes that have been identified by our pSILAC approach and by 3 out of 4 independent RNA screens show a high correlation of expression regulation. R = Pearson correlation coefficient.

Direct comparison of protein expression changes identified by pulsed SILAC and corresponding mRNAs from transcriptome analyses (9, 11, 12, 14) reveals a strong correlation between 3 of the 4 different experiments with a Pearson correlation coefficient of 0.76 to 0.9, whereas one correlation was considerably smaller (0.4) (Fig. 4B–4E). This lower correlation can be explained by the low number of shared downregulated genes found in both studies. It is interesting to note that the degree of correlation is independent of the experimental approach that was used for RNA detection (microarray or RNA-seq). The fold changes we observe at the protein level are smaller compared with the changes of the corresponding RNAs which can be explained by the different experimental designs. Although we exclusively detected proteins which were labeled during a relatively short period (6 h), the transcriptome studies detected RNAs which accumulated up to 96 h after UPF1 depletion (9, 11, 14). We chose this relatively short labeling time to ensure comparability between the UPF1 depletion and the ER stress experiment and to avoid confounding of data interpretation by protein degradation. Moreover, the transcriptome studies did not differentiate between protein-coding and non-coding transcripts. The fold change of the RNA is the sum of all (coding and noncoding) transcripts of a gene, whereas the proteomics approach detected proteins translated only from the subset of protein-coding transcripts. Furthermore, protein synthesis is a highly regulated process in the cell (39–41) and not every protein-coding transcript is translated at the same rate (42, 43).

Five gene products (GABARAPL1, STC2, IFRD1, PEA15, ARFRP1) were found to be up-regulated in all five experiments, all of which contain either an upstream open reading frame (uORF, whose termination codon might trigger NMD), a long 3′UTR or both (Table I). The identified peptides are evenly distributed over the full length of the principal isoform in most cases, indicating that we quantified mostly full-length proteins. Supporting the previously published model of an auto-regulatory NMD feedback loop (14, 44), we also detect up-regulation of the known NMD factors UPF2, UPF3B, SMG5 and SMG7 at the protein level (supplemental Table S1). The overlap between the transcriptomic and the proteomic data sets shows that a subset of up-regulated mRNA is translated and likely contributes to altered cellular function.

Table I

Transcripts identified in all global screens for UPF1 targets contain NMD-inducing features
GenePrincipal isoform
Identified proteinLog2-fold change after siUpf1 depletion
3′UTR lengthuORFpSILACMendell (9)Viegas (12)Tani (11)Yepiskoposyan (14)
GABARAPL11278yesN-term. peptides1.182.152.292.421.11
STC23134yesfull-length0.972.541.773.181.60
IFRD1673yesfull-length0.631.811.452.441.78
PEA151890yesfull-length0.542.012.652.211.39
ARFRP1987nofull-length0.512.661.151.870.92

NMD-inducing Characteristics in Identified UPF1 Targets

Known NMD-inducing properties include the deposition of an EJC within the 3′UTR at least 50 nucleotides downstream of the termination codon (1, 2, 45), the presence of an uORF in the 5′UTR (46), or a long 3′UTR (>1kb) (6, 7). We thus analyzed the mRNAs encoding the 30 most up-regulated proteins (1.8–2.8-fold) for the presence of one or more of these NMD-inducing features. The 30 most downregulated (1.8–3.2-fold) as well as the 30 most steadily expressed ('least regulated') proteins served as control groups. The mRNAs encoding the most up-regulated proteins show a highly significant enrichment for 3′UTR length > 1kb (Fig. 5A). In this group, twice as many principal transcripts harbor a 3′UTR longer than 1 kb (22/30) than in the control groups (11/30, p = 0.0098 and 9/30, p = 0.017, respectively). Furthermore, the 3′UTRs of the principal transcripts of the up-regulated proteins are significantly longer than the 3′UTRs of the other groups (median of 1325 nt versus 559 nt (p = 0.0183) and 690 nt (p = 0.0057), respectively) (Fig. 5C). We validated this analysis by reanalyzing previously published RNA-seq data (11), which confirmed the marked difference in the number of translated mRNAs with long 3′UTRs and also in the length of the 3′UTRs for up- and downregulated proteins (Fig. 5B and ​and55D). By contrast, neither the presence of uORFs nor of annotated 3′UTR introns is significantly enriched in the mRNAs that encode NMD-induced proteins (supplemental Fig. S1), albeit there is a trend of uORF-containing transcripts to be more common for the up-regulated group. We thus conclude that a long 3′UTR is a key NMD-inducing property of translated physiological, NMD-regulated transcripts.

An external file that holds a picture, illustration, etc. Object name is zjw0051653070005.jpg

mRNAs that show increased protein synthesis following UPF1 depletion are enriched for those with very long 3′UTRs. A, The principal transcripts of the 30 most up- or downregulated and the 30 least regulated genes from the group of significant UPF1 targets were analyzed for the length of the 3′UTR. Sequence information was taken from the Ensembl database. Significantly more up-regulated UPF1 target mRNAs contain a long 3′UTR (>1kb) compared with downregulated targets. Fisher exact test was applied for statistical analysis. B, Same analysis as in (A) with 28 most up- and downregulated from the list of targets that overlap between pSILAC screen and RNA-seq (11). mRNA equivalents of only 28 downregulated proteins were found in the RNAseq, hence also the 28 most up-regulated transcripts were used for the comparison. C, D, Length of the 3′UTRs of the principal transcripts from (A) and (B). Dots indicate the individual length of the 3′UTR, the horizontal bars represent the medians. Significance was analyzed by Mann-Whitney test.

Identification of De Novo Synthesized Proteins in Response to ER Stress

NMD efficiency can be affected by endoplasmic reticulum (ER) stress (16–19), and a regulatory feedback loop between NMD and the unfolded protein response has been proposed (16, 17). Hence, we were interested to determine the overlap of newly synthesized proteins in response to ER stress and NMD inhibition by UPF1 depletion. We performed combined AHA and SILAC labeling followed by LC-MS/MS analysis of enriched proteins for cells subjected to mild ER stress. For better comparability of the two pulsed SILAC experiments (i.e. siUPF1 transfection and ER stress induction) these were performed in parallel and the same negative control was used for both treatments. We treated control siRNA-transfected cells with 1.5 mm DTT or the solvent for 6 h and used BiP as a marker of ER-stress induction, which was strongly induced in DTT-treated cells (Fig. 6A). In parallel, the NMD reporter was up-regulated 3.5-fold at the protein level and endogenous NMD target mRNAs were also up-regulated 2–4-fold by ER stress induction with DTT (Fig. 6B and ​and66C). The LC-MS/MS analysis identified 5201 proteins that could be quantified in both biological replicates and whose expression changes were normally distributed (Fig. 6D and ​and66E). We found 99 of these to be significantly regulated (FDR < 0.05), with 58 up- and 41 down-regulated proteins. As expected, ER stress response proteins (GO:0034976) were highly enriched in the up-regulated group (26-fold, p = 8 × 10−09) and all quantified UPR proteins were also induced (Fig. 7A and ​and7C).7C). The NMD factors UPF1, UPF2, UPF3B and the EJC component Y14 are among the downregulated proteins (supplemental Fig. S3) offering a possible explanation for the inhibition of NMD by ER stress.

An external file that holds a picture, illustration, etc. Object name is zjw0051653070006.jpg

Identification of de novo synthesized proteins in response to ER stress. A, HeLa cells were transfected with siRNA against UPF1 or a control siRNA. Control cells were treated with 1.5 mm DTT for 6 h. Protein expression of UPF1 and the ER stress marker BiP was visualized by Western blotting. BiP is up-regulated by DTT treatment but not in UPF1-depleted cells. B–E, HeLa cells stably expressing the NMD reporter Renilla-HBB NS39 treated with 1.5 mm DTT for 6 h. During the treatment cells were also incubated in methionine, arginine and lysine-free DMEM containing AHA and isotope-labeled arginine and lysine. Isotope labels were reversed in biological duplicates. B, Up-regulation of the NMD reporter Renilla-HBB NS39 was measured by luciferase assay. C, RT-qPCR was used to measure the expression level of endogenous NMD target RNAs. D, 5199 proteins were quantified in both biological replicates. Significantly regulated proteins (FDR < 0.05) are highlighted in red. Proteins shown in gray were removed from statistical analysis because of their high standard deviation. R = Pearson correlation coefficient. E, Distribution of the average change of expression after DTT treatment.

An external file that holds a picture, illustration, etc. Object name is zjw0051653070007.jpg

UPF1 depletion specifically up-regulates components of the PERK/IRE1 ER stress response pathways. A, B, Scatter plots showing the high correlation of the change of UPR protein expression between both biological replicates. Proteins marked with an asterisk were identified with an FDR < 0.05 by Benjamini-Hochberg analysis. A, Proteins involved in ER stress response or activated by ER stress are up-regulated by DTT treatment. B, UPF1 depletion causes up-regulation of ER stress proteins regulated by the PERK/IRE1 pathways (green triangles, upper right quadrant) but not of ATF6-regulated proteins (orange rectangles). C, Average fold change of ER stress response proteins. Light bars - regulation after DTT treatment, dark bars - regulation after UPF1 knockdown. XBP1 and HYOU1 were detected in only one replicate of the UPF1 knockdown experiment and hence could not be quantified. D, HeLa cells stably transfected with either Renilla-HBB WT or NS39 were treated with 50 μg/ml CHX for 6 h, harvested and RNA was extracted and reverse transcribed. Expression of Renilla-HBB and putative endogenous NMD targets was analyzed by RT-qPCR. Bars represent means of 3 (HBB) or 6 (endogenous mRNAs) independent experiments, ± S.E. (E and F) HeLa cells were transfected with siRNA against UPF1 or a control siRNA and a reporter plasmid which encodes firefly luciferase controlled by an ATF4 or ATF6-response element. A plasmid encoding Renilla luciferase was co-transfected as normalization control. Cells were treated with 1.5 mm DTT or H2O for 6 h, harvested and luciferase activity was analyzed with a Dual-Glo luciferase™ assay. Bars represent means of 4 independent experiments, ± S.E. Statistical analysis of (D–F) was done by two-tailed t test (* = p < 0.05, ** = p < 0.01, *** = p < 0.001, **** = p < 0.0001) (G) Immunoblot analysis of the lysate used in (E) and (F) using specific antibodies against UPF1, BiP and β-Actin.

NMD Inhibition Causes Increased Synthesis of ER Stress Proteins Regulated by the PERK/IRE1 Branch of the UPR

It has been postulated on the basis of transcriptome data that ER stress and NMD are linked via a positive feedback loop, in that ER stress not only impairs NMD efficiency but that this inhibition will in turn further activate the UPR (16, 17). We tested this hypothesis by comparing the expression change of 22 ER stress proteins, which are regulated by all three branches of ER stress response and were quantified by mass spectrometry following DTT treatment. The synthesis of all of these proteins was up-regulated by ER stress with the exception of calnexin whose expression did not change (Fig. 7A). Twenty of these proteins could also be quantified following NMD inhibition by UPF1 depletion. Interestingly, all proteins up-regulated by NMD inhibition have been recognized as targets of either the PERK or the IRE1 pathway (TXNIP, STC2, PTGS2, ASNS, PRNP, ATF3; (47–54)), and all of their principal transcripts harbor NMD-inducing features (Table II). In contrast, we did not detect up-regulation of proteins known to be activated by the ATF6 branch. Those were either downregulated (HERP) or did not respond to inhibition of NMD (BiP, SEL1L, DNAJC3, DNAJB11, GRP94, Calreticulin, PDIA4; (22, 23)) (Fig. 7B and ​and77C). This is consistent with the observation that ATF6 itself is downregulated in response to UPF1 depletion (Fig. 7A and ​and77C). These data thus indicate that ER stress and NMD inhibition are linked by the PERK and the IRE1 pathways, but not by the ATF6 branch of the UPR.

Table II

ER stress proteins upregulated by the inhibition of NMD ([check] - is activated, X–is not activated, n.a.–not analysed)
ER stress response genePrincipal transcript
Identified proteinER stress activation by
3′UTR lengthuORFPERKIRE1ATF6
TXNIP1417nofull-length[check] (49)[check] (49, 50)X (50)
PTGS22541nofull-length[check] (48)[check] (48)n.a.
STC23134yesfull-length[check] (52)X (52)X (52)
PRNP1606yesfull-lengthn.a.[check] (53, 54)[check] (54)
ASNS142yesfull-length[check] (51)X (51)X (51)
ATF31202yesfull-length[check] (47)n.a.n.a.

We next asked whether NMD inhibition up-regulates stress response proteins by activating the ER stress response signaling, including upstream ER stress regulators such as ATF4, or whether these ER stress-response proteins are directly induced by NMD inhibition because their mRNAs are NMD targets. To test whether the PERK-responsive genes TXNIP, STC2, and PTGS2 are direct NMD targets, we inhibited NMD by incubation with cycloheximide, isolated RNA and analyzed steady-state RNA levels by RT-qPCR. All mRNAs tested were up-regulated 4 to 10-fold, consistent with them being directly regulated by NMD (Fig. 7D). To address the alternative possibility that these responses are elicited by UPR signaling as a consequence of NMD inhibition, we tested whether depletion of UPF1 activates the ATF4 or ATF6 pathway. We transiently transfected reporter plasmids containing a firefly luciferase expression cassette bearing an ATF4 or ATF6 response element into UPF1-depleted or control HeLa cells. We co-transfected a Renilla luciferase plasmid as normalization control. Although DTT treatment activates the ATF4 and ATF6-responsive promoters as expected, UPF1 depletion alone does not affect firefly luciferase activity (Fig. 7E and ​and77F). The expression of BiP is also not affected by depletion of UPF1 (Fig. 6A, ​,77B, and ​and77C), indicating that NMD inhibition is not sufficient to activate the whole UPR signaling cascade. We conclude that the absence of UPF1 and the resulting inhibition of NMD do not detectably potentiate the activity of the UPR key regulators ATF4 and ATF6, and that TXNIP, STC2, and PTGS2 appear to be directly regulated by NMD at the RNA level.

DISCUSSION

This work describes NMD as a regulated rather than a constitutive process. NMD inhibition by stress increases the expression of physiological NMD targets that contribute to the stress response. Our data implicate long 3′UTRs as the major NMD-inducing feature of endogenous NMD target mRNAs that are subsequently translated. The data reported here also show that NMD inhibition induces an ER stress response specifically through the PERK and IRE1 pathways, but not through the ATF6 pathway.

Previous transcriptomic studies have identified physiological NMD target mRNAs after depletion of UPF1, many of which encode proteins involved in the stress response (9–14). It is important to note that, in general, transcript levels correlate poorly with the abundance of proteins, although correlation is better for differentially expressed mRNAs (55–57). It is therefore biologically highly relevant to determine to what extent endogenous NMD target mRNAs are indeed translated into functional proteins. Answering this question is of particular importance because stress can cause global inhibition of translation which would prevent the expression of proteins encoded by NMD target mRNAs (58). In a previous proteomic study NMD inhibition did not result in an up-regulation of proteins encoded by NMD target mRNAs (59). However, the authors of this study employed 2D difference gel electrophoresis (2D-DiGE) multi-gel study with protein identification by LC-MS/MS, which is a method with a bias for high abundant proteins and proteins with low abundance might have escaped the analysis (60).

Here, we have conducted a global analysis of de novo protein synthesis monitoring the effects of stress and NMD inhibition on the proteome. Because only newly synthesized, labeled proteins are quantified, the sensitivity to detect changes in the proteome is strongly increased. As expected, we identified many previously described endogenous NMD targets among the up-regulated proteins following UPF1 depletion. We note that the changes of de novo protein synthesis tended to be quantitatively moderate, similar to the subtle differential protein expression observed for other regulated and biologically highly relevant pathways (61, 62).

In the experimental system employed here, we used conditions of mild ER stress that nevertheless resulted in a robust induction of the unfolded protein response. The link between the induction of ER stress and NMD inhibition was indicated by the induction of de novo protein synthesis of endogenous NMD targets by DTT treatment. These data support the hypothesis that endogenous NMD targets contribute to the cellular stress response and potentially to recovery (9, 15). Our analysis further revealed a branch-specific regulation of UPR factors by NMD inhibition, as only PERK and IRE1-responsive proteins were up-regulated but none of the ATF6-responsive proteins. Because the activated proteins TXNIP, PTGS2, STC2, ASNS and PRNP were all detected as full-length proteins in the LC-MS/MS analysis, they should be fully functional.

The up-regulation of several ER stress-responsive proteins by NMD inhibition leads to the question of whether down-regulation of UPF1 may cause stress-independent enrichment of their transcripts (because they are direct NMD targets), or whether NMD inhibition causes ER stress which in turn would activate the UPR and finally lead to the increased expression of ER stress-responsive proteins. Our data support the interpretation that the identified genes are directly regulated by NMD, because inhibition of translation, and hence NMD, leads to a strong increase in the abundance of their transcripts. Moreover, UPR-responsive promoter elements and the UPR marker BiP are not activated by UPF1 depletion, indicating that the UPR is not activated per se. Our findings suggest that NMD contributes as a post-transcriptional mechanism to the regulatory network controlling the expression of this subset of PERK and IRE1-responsive genes. Although the UPR signaling cascades of PERK and IRE1 activate transcription of these genes, NMD controls the stability of their functional transcripts, probably via their long 3′UTRs. Interestingly, other post-transcriptional mechanisms such as binding of miRNAs or AU-rich element-binding proteins add further modularity to the regulation of these genes (49, 63).

Another explanation for the up-regulation of IRE1 responsive genes is provided by a recent study of Karam et al. (16). The authors identified IRE1 as a direct NMD target and postulate that NMD shapes the UPR by controlling the RNA stability of the key regulator IRE1. Although we did not detect IRE1 in our mass spectrometry analysis, our protein data of downstream UPR factors support and expand this model by assigning the NMD-regulated UPR factors specifically to the PERK and IRE1 branches of the UPR.

We did not observe an up-regulation of either ATF6 or ATF6 target genes on the protein level after UPF1 depletion, indicating a branch-specific regulation of UPR genes by NMD. In line with this, ATF6 mRNA was either not affected or destabilized after UPF1 depletion in previous studies (9, 11, 12, 14, 16). ATF6 mainly regulates the expression of molecular chaperones such as BiP or GRP94, whereas the target genes of the PERK and IRE1 branches have more diverse functions such as enzyme activity and therefore might benefit from a tighter control of expression (23).

Taken together, we suggest (1) that physiological NMD target mRNAs will be translated into functional proteins if NMD efficiency is downregulated, (2) that the cellular stress response involves NMD inhibition, and (3) that stabilized NMD target mRNAs belonging to the PERK and IRE1 pathways of the UPR are translated into proteins whereas target genes of the ATF6 branch do not appear to be detectably regulated by NMD.

Proteomics data

The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium (64) via the PRIDE partner repository with the data set identifier PXD002648.

Supplementary Material

Supplemental Data:

Acknowledgments

We thank Sophia Föhr (EMBL, Heidelberg, Germany) and Mandy Medenhoff (Heidelberg University, Heidelberg, Germany) for excellent technical assistance. We thank Georg Stoecklin and Sarah Hofmann (DKFZ-ZMBH Alliance, Heidelberg, Germany) for helpful discussion.

Footnotes

Contributed by

Author contributions: JS designed the study, performed the experimental work, interpreted, analyzed the data, and wrote the manuscript. CH, MB contributed to the experimental work and data analysis and provided conceptual advice. SL and JK performed the quantitative mass spectrometry experiments and analysed the mass spectrometry data. JS, GNY, AEK, MWH conceptualized the study and AEK, MWH and JK edited the manuscript.

* This work was supported by the Heidelberg University in the context of the “Innovationsfond FRONTIER” and the DFG in the context of FOR855 and SFB 1036.

An external file that holds a picture, illustration, etc. Object name is sbox.jpg This article contains supplemental material.

1 The abbreviations used are:

AHA
azidohomoalanine
CHX
cycloheximide
EJC
exon-junction complex
NMD
Nonsense-mediated mRNA decay
pSILAC
pulsed stable isotope labeling by amino acids in cell culture
PTC
premature termination codon
SILAC
stable isotope labeling by amino acids in cell culture
UPR
unfolded protein response.

REFERENCES

1. Belgrader P., Cheng J., Zhou X., Stephenson L. S., and Maquat L. E. (1994) Mammalian nonsense codons can be cis effectors of nuclear mRNA half-life. Mol. Cell. Biol. 14, 8219–8228 [Europe PMC free article] [Abstract] [Google Scholar]
2. Thermann R., Neu-Yilik G., Deters A., Frede U., Wehr K., Hagemeier C., Hentze M. W., and Kulozik A. E. (1998) Binary specification of nonsense codons by splicing and cytoplasmic translation. EMBO J. 17, 3484–3494 [Europe PMC free article] [Abstract] [Google Scholar]
3. Holbrook J. A., Neu-Yilik G., Hentze M. W., and Kulozik A. E. (2004) Nonsense-mediated decay approaches the clinic. Nat. Genetics 36, 801–808 [Abstract] [Google Scholar]
4. Nagy E., and Maquat L. E. (1998) A rule for termination-codon position within intron-containing genes: when nonsense affects RNA abundance. Trends Biochem. Sci. 23, 198–199 [Abstract] [Google Scholar]
5. Kashima I., Yamashita A., Izumi N., Kataoka N., Morishita R., Hoshino S., Ohno M., Dreyfuss G., and Ohno S. (2006) Binding of a novel SMG-1-Upf1-eRF1-eRF3 complex (SURF) to the exon junction complex triggers Upf1 phosphorylation and nonsense-mediated mRNA decay. Genes Develop. 20, 355–367 [Europe PMC free article] [Abstract] [Google Scholar]
6. Amrani N., Ganesan R., Kervestin S., Mangus D. A., Ghosh S., and Jacobson A. (2004) A faux 3′-UTR promotes aberrant termination and triggers nonsense-mediated mRNA decay. Nature 432, 112–118 [Abstract] [Google Scholar]
7. Buhler M., Steiner S., Mohn F., Paillusson A., and Muhlemann O. (2006) EJC-independent degradation of nonsense immunoglobulin-mu mRNA depends on 3′ UTR length. Nat. Structural Mol. Biol. 13, 462–464 [Abstract] [Google Scholar]
8. He F., Li X., Spatrick P., Casillo R., Dong S., and Jacobson A. (2003) Genome-wide analysis of mRNAs regulated by the nonsense-mediated and 5′ to 3′ mRNA decay pathways in yeast. Mol. Cell 12, 1439–1452 [Abstract] [Google Scholar]
9. Mendell J. T., Sharifi N. A., Meyers J. L., Martinez-Murillo F., and Dietz H. C. (2004) Nonsense surveillance regulates expression of diverse classes of mammalian transcripts and mutes genomic noise. Nat. Gen. 36, 1073–1078 [Abstract] [Google Scholar]
10. Schmidt S. A., Foley P. L., Jeong D. H., Rymarquis L. A., Doyle F., Tenenbaum S. A., Belasco J. G., and Green P. J. (2015) Identification of SMG6 cleavage sites and a preferred RNA cleavage motif by global analysis of endogenous NMD targets in human cells. Nucleic Acids Res. 43, 309–323 [Europe PMC free article] [Abstract] [Google Scholar]
11. Tani H., Imamachi N., Salam K. A., Mizutani R., Ijiri K., Irie T., Yada T., Suzuki Y., and Akimitsu N. (2012) Identification of hundreds of novel UPF1 target transcripts by direct determination of whole transcriptome stability. RNA Biol. 9, 1370–1379 [Europe PMC free article] [Abstract] [Google Scholar]
12. Viegas M. H., Gehring N. H., Breit S., Hentze M. W., and Kulozik A. E. (2007) The abundance of RNPS1, a protein component of the exon junction complex, can determine the variability in efficiency of the Nonsense Mediated Decay pathway. Nucleic Acids Res. 35, 4542–4551 [Europe PMC free article] [Abstract] [Google Scholar]
13. Wittmann J., Hol E. M., and Jack H. M. (2006) hUPF2 silencing identifies physiologic substrates of mammalian nonsense-mediated mRNA decay. Mol. Cell. Biol. 26, 1272–1287 [Europe PMC free article] [Abstract] [Google Scholar]
14. Yepiskoposyan H., Aeschimann F., Nilsson D., Okoniewski M., and Muhlemann O. (2011) Autoregulation of the nonsense-mediated mRNA decay pathway in human cells. Rna 17, 2108–2118 [Europe PMC free article] [Abstract] [Google Scholar]
15. Gardner L. B. (2008) Hypoxic inhibition of nonsense-mediated RNA decay regulates gene expression and the integrated stress response. Mol. Cell. Biol. 28, 3729–3741 [Europe PMC free article] [Abstract] [Google Scholar]
16. Karam R., Lou C. H., Kroeger H., Huang L., Lin J. H., and Wilkinson M. F. (2015) The unfolded protein response is shaped by the NMD pathway. EMBO Reports 16, 599–609 [Europe PMC free article] [Abstract] [Google Scholar]
17. Oren Y. S., McClure M. L., Rowe S. M., Sorscher E. J., Bester A. C., Manor M., Kerem E., Rivlin J., Zahdeh F., Mann M., Geiger T., and Kerem B. (2014) The unfolded protein response affects readthrough of premature termination codons. EMBO Mol. Med. 6, 685–701 [Europe PMC free article] [Abstract] [Google Scholar]
18. Sakaki K., Yoshina S., Shen X., Han J., DeSantis M. R., Xiong M., Mitani S., and Kaufman R. J. (2012) RNA surveillance is required for endoplasmic reticulum homeostasis. Proc. Natl. Acad. Sci. U.S.A. 109, 8079–8084 [Europe PMC free article] [Abstract] [Google Scholar]
19. Wang D., Zavadil J., Martin L., Parisi F., Friedman E., Levy D., Harding H., Ron D., and Gardner L. B. (2011) Inhibition of nonsense-mediated RNA decay by the tumor microenvironment promotes tumorigenesis. Mol. Cell. Biol. 31, 3670–3680 [Europe PMC free article] [Abstract] [Google Scholar]
20. Harding H. P., Zhang Y., and Ron D. (1999) Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 397, 271–274 [Abstract] [Google Scholar]
21. Harding H. P., Novoa I., Zhang Y., Zeng H., Wek R., Schapira M., and Ron D. (2000) Regulated translation initiation controls stress-induced gene expression in mammalian cells. Mol. Cell 6, 1099–1108 [Abstract] [Google Scholar]
22. Yoshida H., Matsui T., Yamamoto A., Okada T., and Mori K. (2001) XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107, 881–891 [Abstract] [Google Scholar]
23. Adachi Y., Yamamoto K., Okada T., Yoshida H., Harada A., and Mori K. (2008) ATF6 is a transcription factor specializing in the regulation of quality control proteins in the endoplasmic reticulum. Cell Structure Function 33, 75–89 [Abstract] [Google Scholar]
24. Haze K., Yoshida H., Yanagi H., Yura T., and Mori K. (1999) Mammalian transcription factor ATF6 is synthesized as a transmembrane protein and activated by proteolysis in response to endoplasmic reticulum stress. Mol. Biol. Cell 10, 3787–3799 [Europe PMC free article] [Abstract] [Google Scholar]
25. Boelz S., Neu-Yilik G., Gehring N. H., Hentze M. W., and Kulozik A. E. (2006) A chemiluminescence-based reporter system to monitor nonsense-mediated mRNA decay. Biochem. Biophys. Res. Commun. 349, 186–191 [Abstract] [Google Scholar]
26. Dreumont N., Maresca A., Boisclair-Lachance J. F., Bergeron A., and Tanguay R. M. (2005) A minor alternative transcript of the fumarylacetoacetate hydrolase gene produces a protein despite being likely subjected to nonsense-mediated mRNA decay. BMC Mol. Biol. 6, 1. [Europe PMC free article] [Abstract] [Google Scholar]
27. Nickless A., Jackson E., Marasa J., Nugent P., Mercer R. W., Piwnica-Worms D., and You Z. (2014) Intracellular calcium regulates nonsense-mediated mRNA decay. Nature Med. 20, 961–966 [Europe PMC free article] [Abstract] [Google Scholar]
28. Paillusson A., Hirschi N., Vallan C., Azzalin C. M., and Muhlemann O. (2005) A GFP-based reporter system to monitor nonsense-mediated mRNA decay. Nucleic Acids Research 33, e54. [Europe PMC free article] [Abstract] [Google Scholar]
29. Gentleman R. C., Carey V. J., Bates D. M., Bolstad B., Dettling M., Dudoit S., Ellis B., Gautier L., Ge Y., Gentry J., Hornik K., Hothorn T., Huber W., Iacus S., Irizarry R., Leisch F., Li C., Maechler M., Rossini A. J., Sawitzki G., Smith C., Smyth G., Tierney L., Yang J. Y., and Zhang J. (2004) Bioconductor: open software development for computational biology and bioinformatics. Genome Biol. 5, R80. [Europe PMC free article] [Abstract] [Google Scholar]
30. Smyth G. K. (2004) Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Statistical Appl. Genetics Mol. Biol. 3, Article3 [Abstract] [Google Scholar]
31. Gehring N. H., Neu-Yilik G., Schell T., Hentze M. W., and Kulozik A. E. (2003) Y14 and hUpf3b form an NMD-activating complex. Mol. Cell 11, 939–949 [Abstract] [Google Scholar]
32. Eichelbaum K., Winter M., Berriel Diaz M., Herzig S., and Krijgsveld J. (2012) Selective enrichment of newly synthesized proteins for quantitative secretome analysis. Nature Biotechnol. 30, 984–990 [Abstract] [Google Scholar]
33. Yang F., Shen Y., Camp D. G. 2nd, and Smith R. D. (2012) High-pH reversed-phase chromatography with fraction concatenation for 2D proteomic analysis. Expert Rev. Proteomics 9, 129–134 [Europe PMC free article] [Abstract] [Google Scholar]
34. Cox J., and Mann M. (2008) MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nature Biotechnol. 26, 1367–1372 [Abstract] [Google Scholar]
35. Cox J., Neuhauser N., Michalski A., Scheltema R. A., Olsen J. V., and Mann M. (2011) Andromeda: a peptide search engine integrated into the MaxQuant environment. J. Proteome Res. 10, 1794–1805 [Abstract] [Google Scholar]
36. Jain E., Bairoch A., Duvaud S., Phan I., Redaschi N., Suzek B. E., Martin M. J., McGarvey P., and Gasteiger E. (2009) Infrastructure for the life sciences: design and implementation of the UniProt website. BMC Bioinformatics 10, 136. [Europe PMC free article] [Abstract] [Google Scholar]
37. Cunningham F., Amode M. R., Barrell D., Beal K., Billis K., Brent S., Carvalho-Silva D., Clapham P., Coates G., Fitzgerald S., Gil L., Giron C. G., Gordon L., Hourlier T., Hunt S. E., Janacek S. H., Johnson N., Juettemann T., Kahari A. K., Keenan S., Martin F. J., Maurel T., McLaren W., Murphy D. N., Nag R., Overduin B., Parker A., Patricio M., Perry E., Pignatelli M., Riat H. S., Sheppard D., Taylor K., Thormann A., Vullo A., Wilder S. P., Zadissa A., Aken B. L., Birney E., Harrow J., Kinsella R., Muffato M., Ruffier M., Searle S. M., Spudich G., Trevanion S. J., Yates A., Zerbino D. R., and Flicek P. (2015) Ensembl 2015. Nucleic Acids Res. 43, D662–669 [Europe PMC free article] [Abstract] [Google Scholar]
38. Somasekharan S. P., Stoynov N., Rotblat B., Leprivier G., Galpin J. D., Ahern C. A., Foster L. J., and Sorensen P. H. (2012) Identification and quantification of newly synthesized proteins translationally regulated by YB-1 using a novel Click-SILAC approach. J. Proteomics 77, e1–10 [Abstract] [Google Scholar]
39. Groppo R., and Richter J. D. (2009) Translational control from head to tail. Curr. Opinion Cell Biol. 21, 444–451 [Europe PMC free article] [Abstract] [Google Scholar]
40. Jackson R. J., Hellen C. U., and Pestova T. V. (2010) The mechanism of eukaryotic translation initiation and principles of its regulation. Nat. Rev. Mol. Cell Biol. 11, 113–127 [Europe PMC free article] [Abstract] [Google Scholar]
41. Hershey J. W., Sonenberg N., and Mathews M. B. (2012) Principles of translational control: an overview. Cold Spring Harbor Perspectives Biol. 4(12), a011528 [Europe PMC free article] [Abstract] [Google Scholar]
42. Schwanhausser B., Busse D., Li N., Dittmar G., Schuchhardt J., Wolf J., Chen W., and Selbach M. (2011) Global quantification of mammalian gene expression control. Nature 473, 337–342 [Abstract] [Google Scholar]
43. Thoreen C. C., Chantranupong L., Keys H. R., Wang T., Gray N. S., and Sabatini D. M. (2012) A unifying model for mTORC1-mediated regulation of mRNA translation. Nature 485, 109–113 [Europe PMC free article] [Abstract] [Google Scholar]
44. Huang L., Lou C. H., Chan W., Shum E. Y., Shao A., Stone E., Karam R., Song H. W., and Wilkinson M. F. (2011) RNA homeostasis governed by cell type-specific and branched feedback loops acting on NMD. Mol. Cell 43, 950–961 [Europe PMC free article] [Abstract] [Google Scholar]
45. Le Hir H., Gatfield D., Izaurralde E., and Moore M. J. (2001) The exon-exon junction complex provides a binding platform for factors involved in mRNA export and nonsense-mediated mRNA decay. EMBO J.. 20, 4987–4997 [Europe PMC free article] [Abstract] [Google Scholar]
46. Gaba A., Jacobson A., and Sachs M. S. (2005) Ribosome occupancy of the yeast CPA1 upstream open reading frame termination codon modulates nonsense-mediated mRNA decay. Mol. Cell 20, 449–460 [Abstract] [Google Scholar]
47. Han J., Back S. H., Hur J., Lin Y. H., Gildersleeve R., Shan J., Yuan C. L., Krokowski D., Wang S., Hatzoglou M., Kilberg M. S., Sartor M. A., and Kaufman R. J. (2013) ER-stress-induced transcriptional regulation increases protein synthesis leading to cell death. Nat. Cell Biol. 15, 481–490 [Europe PMC free article] [Abstract] [Google Scholar]
48. Hung J. H., Su I. J., Lei H. Y., Wang H. C., Lin W. C., Chang W. T., Huang W., Chang W. C., Chang Y. S., Chen C. C., and Lai M. D. (2004) Endoplasmic reticulum stress stimulates the expression of cyclooxygenase-2 through activation of NF-kappaB and pp38 mitogen-activated protein kinase. J. Biol. Chem. 279, 46384–46392 [Abstract] [Google Scholar]
49. Lerner A. G., Upton J. P., Praveen P. V., Ghosh R., Nakagawa Y., Igbaria A., Shen S., Nguyen V., Backes B. J., Heiman M., Heintz N., Greengard P., Hui S., Tang Q., Trusina A., Oakes S. A., and Papa F. R. (2012) IRE1alpha induces thioredoxin-interacting protein to activate the NLRP3 inflammasome and promote programmed cell death under irremediable ER stress. Cell Metabolism 16, 250–264 [Europe PMC free article] [Abstract] [Google Scholar]
50. Oslowski C. M., Hara T., O'Sullivan-Murphy B., Kanekura K., Lu S., Hara M., Ishigaki S., Zhu L. J., Hayashi E., Hui S. T., Greiner D., Kaufman R. J., Bortell R., and Urano F. (2012) Thioredoxin-interacting protein mediates ER stress-induced beta cell death through initiation of the inflammasome. Cell Metabolism 16, 265–273 [Europe PMC free article] [Abstract] [Google Scholar]
51. Gjymishka A., Su N., and Kilberg M. S. (2009) Transcriptional induction of the human asparagine synthetase gene during the unfolded protein response does not require the ATF6 and IRE1/XBP1 arms of the pathway. Biochem. J. 417, 695–703 [Europe PMC free article] [Abstract] [Google Scholar]
52. Ito D., Walker J. R., Thompson C. S., Moroz I., Lin W., Veselits M. L., Hakim A. M., Fienberg A. A., and Thinakaran G. (2004) Characterization of stanniocalcin 2, a novel target of the mammalian unfolded protein response with cytoprotective properties. Mol. Cell. Biol. 24, 9456–9469 [Europe PMC free article] [Abstract] [Google Scholar]
53. Misiewicz M., Dery M. A., Foveau B., Jodoin J., Ruths D., and LeBlanc A. C. (2013) Identification of a novel endoplasmic reticulum stress response element regulated by XBP1. J. Biol. Chem. 288, 20378–20391 [Europe PMC free article] [Abstract] [Google Scholar]
54. Dery M. A., Jodoin J., Ursini-Siegel J., Aleynikova O., Ferrario C., Hassan S., Basik M., and LeBlanc A. C. (2013) Endoplasmic reticulum stress induces PRNP prion protein gene expression in breast cancer. Breast Cancer Res. 15, R22. [Europe PMC free article] [Abstract] [Google Scholar]
55. Vogel C., and Marcotte E. M. (2012) Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat. Rev.. Genetics 13, 227–232 [Europe PMC free article] [Abstract] [Google Scholar]
56. de Sousa Abreu R., Penalva L. O., Marcotte E. M., and Vogel C. (2009) Global signatures of protein and mRNA expression levels. Mol. bioSystems 5, 1512–1526 [Europe PMC free article] [Abstract] [Google Scholar]
57. Koussounadis A., Langdon S. P., Um I. H., Harrison D. J., and Smith V. A. (2015) Relationship between differentially expressed mRNA and mRNA-protein correlations in a xenograft model system. Sci. Reports 5, 10775 [Europe PMC free article] [Abstract] [Google Scholar]
58. Wek R. C., Jiang H. Y., and Anthony T. G. (2006) Coping with stress: eIF2 kinases and translational control. Biochem. Soc. Trans. 34, 7–11 [Abstract] [Google Scholar]
59. McGlincy N. J., Tan L. Y., Paul N., Zavolan M., Lilley K. S., and Smith C. W. (2010) Expression proteomics of UPF1 knockdown in HeLa cells reveals autoregulation of hnRNP A2/B1 mediated by alternative splicing resulting in nonsense-mediated mRNA decay. BMC Genomics 11, 565. [Europe PMC free article] [Abstract] [Google Scholar]
60. Baggerman G., Vierstraete E., De Loof A., and Schoofs L. (2005) Gel-based versus gel-free proteomics: a review. Combinatorial Chem. High Throughput Screening 8, 669–677 [Abstract] [Google Scholar]
61. Gehring N. H., Frede U., Neu-Yilik G., Hundsdoerfer P., Vetter B., Hentze M. W., and Kulozik A. E. (2001) Increased efficiency of mRNA 3′ end formation: a new genetic mechanism contributing to hereditary thrombophilia. Nat. Genet. 28, 389–392 [Abstract] [Google Scholar]
62. McFaline-Figueroa J. L., Braun C. J., Stanciu M., Nagel Z. D., Mazzucato P., Sangaraju D., Cerniauskas E., Barford K., Vargas A., Chen Y., Tretyakova N., Lees J. A., Hemann M. T., White F. M., and Samson L. D. (2015) Minor Changes in Expression of the Mismatch Repair Protein MSH2 Exert a Major Impact on Glioblastoma Response to Temozolomide. Cancer Res. 75, 3127–3138 [Europe PMC free article] [Abstract] [Google Scholar]
63. Harper K. A., and Tyson-Capper A. J. (2008) Complexity of COX-2 gene regulation. Biochem. Soc. Trans. 36, 543–545 [Abstract] [Google Scholar]
64. Vizcaino J. A., Cote R. G., Csordas A., Dianes J. A., Fabregat A., Foster J. M., Griss J., Alpi E., Birim M., Contell J., O'Kelly G., Schoenegger A., Ovelleiro D., Perez-Riverol Y., Reisinger F., Rios D., Wang R., and Hermjakob H. (2013) The PRoteomics IDEntifications (PRIDE) database and associated tools: status in 2013. Nucleic Acids Res. 41, D1063–1069 [Europe PMC free article] [Abstract] [Google Scholar]
Articles from Molecular & Cellular Proteomics : MCP are provided here courtesy of American Society for Biochemistry and Molecular Biology

Full text links 

Read article at publisher's site: https://doi.org/10.1074/mcp.m115.054056

Read article for free, from open access legal sources, via Unpaywall: https://www.mcponline.org/content/mcprot/15/5/1584.full.pdfUnpaywall

Citations & impact 

Impact metrics

19
Citations
Jump to Citations
1
Data citation
Jump to Data

Citations of article over time

Alternative metrics

Altmetric item for https://www.altmetric.com/details/5873730
Altmetric
Discover the attention surrounding your research
https://www.altmetric.com/details/5873730

Article citations

Go to all (19) article citations

Data 

Data behind the article

This data has been text mined from the article, or deposited into data resources.

BioStudies: supplemental material and supporting data

ProteomeXchange

Similar Articles 

To arrive at the top five similar articles we use a word-weighted algorithm to compare words from the Title and Abstract of each citation.