Sublethal heat treatment

An in vitro model of insufficient thermal ablation was established based on the method described in a previous report, with minor modifications [37]. Briefly, HCC cells were seeded in 6-well plates. The cells reached 70–80% confluence after 24 h of culture. Then, medium that was prewarmed at 46 °C was added to the wells. The cells were subsequently submerged into a water bath that was preheated at 46 °C for 15 min. After with the medium was replaced with fresh medium that had been kept at 37 °C, the cells were returned to the incubator. NAC (5 mM) or MitoTEMPO (500 nM) was administered 1 h after heat treatment and incubated for 4 h. DPI (10 μM) and VAS2870 (10 μM) were added 30 min after heat treatment and incubated for 4 h. FCCP (1 μM), bardoxolone(0. 5 μM) and Mdivi-1 (10 μM) were used for pretreatment for 1 h.

Cell viability assays

Cells were seeded and reached 70–80% confluence after 24 h of culture. The cell viability was first determined before heat treatment. The cells were then exposed to 46 °C for 15 min, and cell viability was measured at 0, 2, 6, 12, and 24 h. At each indicated time point after heat treatment, the cells were trypsinized and harvested by centrifugation (1200×rpm, 4 min). The cells were resuspended and mixed with 0.4% trypan blue solution. Cell viability was evaluated by counting the number of cells that excluded the dye.

ROS and mitochondrial superoxide production measurement

ROS production was measured using DCFH-DA. MitoSOX™ Red was used to measure mitochondrial superoxide production. Both indicators were dissolved in dimethyl sulfoxide (DMSO) and diluted to working concentrations in Hank’s balanced salt solution. Cells exposed to heat stress were trypsinized and harvested at the indicated times. Then, the collected cells were resuspended in PBS with either 10 μM DCFH-DA or 5 mM MitoSOX™ Red and incubated at 37 °C for 20 min. The fluorescence signal was measured by using flow cytometry(CytoFLEX) at 485 nm/538 nm for DCFH-DA and 510 nm/590 nm for MitoSOX™ Red.

Determination of the glutathione (GSH) levels

A commercial glutathione assay kit(Beyotime, China) was used for GSH level measurement. The experiment was carried out based on the manufacturer’s instructions. Cells were collected by centrifugation(1000×rpm,5 min). The precipitates were mixed with a triple volume of protein removal reagent. After being frozen twice, the cells were centrifuged at 10000×g for 10 min and the supernatants were collected. The GSH detection agent was mixed and 150 μL was added per well. After adding 10 μL of sample and incubating at room temperature for 5 min, 50 μL of NADPH was added, and the absorbance of the well was measured at 412 nm. The GSH levels were calculated based on a standard curve.

Measurement of total antioxidant capacity (T-COA) and superoxide dismutase (SOD) activity

The total antioxidant capacity assay was conducted based on the manufacturer’s instructions (Beyotime, China). Cells were washed and transferred to a homogenizer. The homogenates were centrifuged at 12000×g for 5 min. The total antioxidant capacity detection agent was prepared based on the instructions, and 200 μL was added per well. After adding 20 μL of sample and incubating, the absorbance of the wells was measured at 734 nm. A commercial total SOD activity assay kit (Beyotime, China)based on WST-8 was used. The cells were lysed and centrifuged at 12000×g for 5 min. The supernatants were collected. The working solution was prepared based on the instructions. Twenty microliters of sample was mixed with SOD detection buffer and WST-8 and incubated at 37 °C for 30 min. The absorbance of the well was measured at 450 nm. The T-COA and SOD activities were calculated based on a standard curve.

Measurement of NADPH oxidase activity

The NADPH oxidase activity of total cell homogenate was assessed by superoxide production. The method was based on lucigenin chemiluminescence described previously [36, 38]. Briefly, cells were lysed in lysis buffer (Beyotime, China) and the proteins were harvested by centrifugation(10000×rpm,15 min).Working buffer(phosphate buffer(50 mM),EDTA(1 mM),sucrose(150 mM) was prepared. After the protein concentrations were measured, 50 μg of protein was added to 500 μL of working buffer. Then, dark-adapted lucigenin(100 μM) was added. Chemiluminescence was measured immediately after NADPH (100 μM) was added at 15 s intervals for 1 min by an EnVision® luminometer.

Mitochondrial membrane potential (MMP) measurement

TMRE was used to assess the MMP. Cells exposed to heat stress or not were treated with NAC or DMSO for the indicated times.Then, the cells were incubated with medium containing 150 nM TMRE. After staining for 20 min at 37 °C, cells were washed, and the fluorescence signal was acquired by flow cytometry (CytoFLEX).

Determination of apoptosis

An Annexin V/PI apoptosis detection kit (BD Biosciences) was used to assess apoptosis. Briefly, cells were trypsinized without EDTA and harvested by centrifugation(200×g, 5 min). Then, 100 μL of 1×binding buffer was used to resuspend the cells. Five microliters of Annexin V and PI were added. After incubation for 15 min at room temperature in the dark, the samples were immediately assessed by using a flow cytometer (CytoFLEX). Apoptotic cells were divided into cells undergoing early(Annexin V+/PI−) or late apoptosis (Annexin V+/PI+). A total of 10,000 cells per condition were analyzed for these measurements..

Small interfering RNA (siRNA) -mediated knockdown

Human NOX4 siRNA was obtained from GenePharma (China). The siRNAs were transfected into cells by using Lipofectamine® 3000 Reagent (Life Technologies) based on the manufacturer’s protocol. Twenty-five picomoles of siRNA per well was used for transfection. The sequences of siRNAs was NOX4 siRNA(5′- AACCUCUUCUUUGUCUUCUACAUGCUGCU−3′) and control siRNA(5′-UUCUCCGAACGUGUCACGUTT -3′).

RNA isolation and real-time PCR

An RNeasy kit (QIAGEN, USA) was adopted to extract total RNA from cultured cells. PrimeScript™ RT Master Mix (Takara, Japan) was used for genomic DNA digestion and reverse transcription. Real-time PCR was performed using SYBR® Green Master Mix (Applied Biosystems) on a thermal cycler (Bio-Rad, USA). GAPDH was chosen as an internal control. The primer sequences of the genes were described as follows:NOX1-F 5'-GGTCAACACGAGGAGAGC-3ʹ; NOX1-R: 5'-CAAGGATCCACTTCCAAGACTC-3'; NOX2-F: 5'-CCCAATCCCTCAGTTTGCT-3'; NOX2-R: 5'-CCTTCTGTTGAGATCGCCAA-3'; NOX3-F: 5'-ACCTTCTGTAGAGACCGCTAT-3'; NOX3-R:5'-TCACATGCATACAAGACCACA.

-3'; NOX4-F:5'-CTGTGGTGTTACTATCTGTATTTTCTC-3''; NOX4-R:5'-CTTGCTGCATTCAGTTCAACA-3'; NOX5-F: 5'-GCCAGTGCCTCAACTTCG-3';

NOX5-R:5'-CCACTACCACGTAGCCCATA-3'; DUOX1-F: 5'-GCGTCTACATG

AGAAATGCCA-3'; DUOX1-R: 5'-GCAGCAGTGCATCCACAT-3'’; DUOX2-F:5'-CGCCACCTACCAGAACATC-3''; DUOX2-R: 5'-GGTAGAGAAGAACTGCTC

AGAG-3'. RIPK1-F: 5′-TCCTCGTTGACCGTGAC-3′; RIPK1-R: 5 -GCCTC

CCTCTGCTTGTT-3′; RIPK3-F: 5′-CCAGCTCGTGCTCCTTGACT-3′:; RIPK3-R: 5′-TTGCGGTCCTTGTAGGTTTG-3′; GAPDH-F:5'-TGACAACAGCCTCAAGAT-3'; GAPDH-R:5'-GAGTCCTTCCACGATACC-3'.

Western blotting analysis

Cells were collected and lysed using RIPA lysis buffer (Beyotime, China) containing 1% protease inhibitor on ice. The supernatants containing proteins were harvested by centrifugation(10,000×rpm,15 min) at 4 °C. Equal protein extracts were separated using SDS‒PAGE (15% or 10%) and then transferred onto polyvinylidene difluoride membranes. After blocked with 5% BSA solution, the membranes were incubated with the relevant antibodies at 4 °C overnight.

Separation of nucleari and mitochondrial fractions

A commercial kit(Beyotime, China) was used to separate separating mitochondria. Based on the manufacturer’s protocol, cells were trypsinized and harvested by centrifugation(200×g,10 min). After washing with PBS, 1 ml mitochondrial isolation solution was added for 10 min on ice, and then the cells were transferred into a homogenizer. Then, the homogenates were centrifuged at 600×g for 10 min at 4 °C. The supernatants were collected and centrifuged at 11000×g for 10 min at 4 °C. The precipitates contained mitochondria and were harvested. The nuclear protein extraction reagent was added to the precipitates..After vortexing, nuclear proteins were harvested by centrifugation(16000×g, 10 min). The supernatants were collected.

Mitochondrial DNA (mtDNA) extraction and copy number quantification

Mitochondria were lysed with mitochondrial lysis buffer on ice for 10 min. Then, 5 μL of enzyme mix was added. After incubation in a 50 °C water bath for 60 min, absolute ethanol was added and incubated for an additional 10 min at − 20 °C. mtDNA was collected by centrifugation at top speed for 5 min.The mtDNA was analyzed by PCR using MT-CO2 (mitochondrially encoded cytochrome c oxidase II): F: 5'-CAAACCTACGCCAAAATCCA-3', R:5'-GAAATGAATGAGCCTACAGA-3'. 18S rDNA (F:5'-TAGAGGGACAAGTGGCGTTC-3' and R:5'-CGCTGAGCCAGTCAGTGT-3') was choosed for measuring nuclear DNA.

Immunofluorescence confocal microscopy (colocalization)

The cells were incubated with MitoTracker™ Deep Red (500 nM) for 10 min. After the medium was removed, the cells were washed, and 4% paraformaldehyde was added to fix for 15 min. Then, the cells were permeabilized using 0.2% Triton X-100 for 10 min. After a 30 min block with 5% BSA, primary antibody was added to the culture dish and incubated at room temperature for 30 min. FITC-conjugated secondary antibodies were added, and further incubated for 30 min. The cells were then stained with DAPI for 10 min. After washing, the cells were observed using a confocal microscope (Zeiss, Germany). MitoTracker™ Deep Red fluorescence was determined at wavelengths of 647/668 nm. All fields were imaged using a 63×objective lens.

Assessment of lysosome and mitochondria colocalization

Mitophagy was assessed by the colocalization of the mitochondria and lysosomes using a confocal system. The cells were incubated with MitoTracker™ Red (500 nM) for 10 min before heat treatment in an incubator. The cells were then washed with fresh medium and subjected to heat treatment. After 12 h, the cells were incubated with LysoTracker™ Green (50 nM) and Hoechst 33,342 for 15 min. The cells were then washed and observed with a Leica confocal system (Zeiss, Germany). MitoTracker™ Red fluorescence was measured at wavelengths of 647/668 nm and LysoTracker™ Green fluorescence was measured at wavelengths of 488/560 nm. Images were taken with a 63×objective.

Measurement of ATP levels

A commercial ATP determination kit(Beyotime, China) was used to measure intracellular ATP levels. After adding lysis buffer to the plates, the cells were scraped. The supernatants were harvested by centrifugation (12,000×g, 5 min). Diluted ATP detection reagent was prepared on ice, and 100 μL was added per well. Then,20 μL of supernatant was then added per well. Luminescence was measured using an EnVision® illuminometer at 5 s after mixing. A BCA protein assay kit was used to measure theprotein concentrations of the supernatant. The ATP levels were normalized to the protein concentration of each sample.

Oxygen consumption rate (OCR) measurement

Extracellular Oxygen Consumption Assay (Abcam, ab197243) and Mitochondrial Stress Test Complete Assay(Abcam, ab232857) kits were combined to measure the extracellular OCR according to the protocol. Briefly, approximately 4×10⁴ cells were seeded in a 96-well clear bottom black plate. After being cultured for the indicated times, the cells were subjected to sublethal heat stress or not. Medium containing NAC or not was added to the cells at 1 h after heat exposure. Ten microliters of fresh medium, oligomycin (15 μM), FCCP (25 μM), or antimycin A (15 μM) was added to the indicated wells 12 h after heat exposure. Then, high sensitivity mineral oil warmed to 37 °C was applied. Signal intensity was immediately measured using the TR fluorescence intensity mode at 380/650 nm by an EnVision® reader.

TUNEL staining

Apoptosis was analyzed in 5 μm thick frozen sections of xenografts that were collected one day after iRFA using TUNEL staining. The sections were dried at room temperature for 20 min and then submerged in 4% paraformaldehyde to fix for 30 min. After washing twice with PBS, 0. 2% Triton X-100 was added and incubated at room temperature for 15 min. The sections were washed twice with PBS again. Equilibration buffer(1X,100 μL) was added and incubated at room temperature for 30 min. Then, TdT enzyme solution was added and incubated at 37 °C for 60 min. The sections were then stained with DAPI for 15 min. Fluorescence was measured using a fluorescence microscope (Leica,Germany). Apoptotic cells displayed red fluorescence under excitation. Blue fluorescence of DAPI was used to quantify the nuclei. Fiji software (ImageJ, Bethesda, MD) was applied to analyze the acquired images. TUNEL-positive cells were normalized to the total number of nuclei in each image.

Establishment of a subcutaneous HCC xenograft model and thermal ablation model in vivo

The HCC xenograft model was established in BALB/c nude mice (male, 4–6 weeks) obtained from the Guangdong Medical Laboratory Animal Center (Guangzhou, China). Isoflurane anesthesia was used for the anesthesia of the animals. Surgical procedures were conducted under aseptic conditions. After local disinfection,HepG2 cells (2×10⁶) were injected subcutaneously into the right axilla of mice using 1 ml syringe. The experiment was not carried out until the diameter of subcutaneous tumors reached approximately 10 mm. The mice were randomly divided into four groups, namely, the control, iRFA, heat, and heat+iRFA groups, with each group including five mice. The RFA electrode was inserted into the tumor and positioned at one-third of the length of the tumor under ultrasound guidance. For iRFA, the ablation power was 5 W for 1 min. Sham ablation was conducted without ablation power. To evaluate postoperative recurrence, the tumor dimensions were measured every 4 days. The volume of tumors was calculated based on the formula: V=(length×width²)/2. On Day 20 after ablation,the mice were sacrificed and the tumor volume and weight were measured and recorded. The mice in the NAC or NAC+iRFA group were injected with 100 mg/kg NAC for 5 days via the tail vein starting 2 h after iRFA.

Inhibition of ROS production sensitizes cells to sublethal heat stress due to increased apoptosis

To further clarify the role of ROS after sublethal heat stress, we eliminated intercellular ROS by adding the ROS scavenger NAC 1 h after sublethal heat stress. First, we measured the MMP, a classical marker of the induction of cell death. Both HepG2 and HuH7 cells exhibited a significant decrease in the MMP at 12 h in the presence of NAC (Fig. 2A, B).This suggest that inhibition of ROS may cause cell death after sublethal heat stress. Then, cell death was assessed by flow cytometry using Annexin V-FITC/PI labeling. Cell death was significantly increased in the NAC treatment group (Fig. 2C, D). Notably, Annexin V+cells were the most significantly increased portion (Fig. 2C, E and F). This suggested that apoptosis is the main type of cell death induced by ROS inhibiton after sublethal heat stress. To further confirm the effect of ROS inhibiton, we measured the expression of apoptosis-related proteins. As shown in Fig. 2G, the protein levels of the active forms of Caspase-3 and BAX were increased, and the protein level of BCL-2 was decreased. In contrast, the mRNA levels of RIPK1 and RIPK3, markers of necroptosis, were not significantly altered (Fig. 2H). These results suggest that the ROS burst after sublethal heat stress exerts a pro-survival effect. The ROS burst after sublethal heat stress was confined to within 12 h (Fig. 1A). To further confirm the pro-survival effect of the ROS burst within 12 h after sublethal heat stress, we determined the effect on apoptosis by adding NAC 12 h after sublethal heat stress. As shown in Fig. 2I, no apoptosis was observed in the group treated with NAC at 12 h after sublethal heat stress. This suggests that the ROS burst within 12 h after sublethal heat stress contributed to the cells survival after sublethal heat stress.

Open in a separate window

Fig. 2

NAC induces apoptosis after sublethal heat stress. HepG2 and HuH7 cells that were untreated or subjected to sublethal heat stress were cultured for 12 h in medium with or without NAC (5 mM). A and B Mitochondrial membrane potential was assessed by TMRE staining and analyzed by flow cytometry at 12 h after sublethal heat stress. C and D Cell death was quantified using Annexin V-FITC/PI staining and flow cytometry at 24 h after sublethal heat stress. Summary graph representing the percentage of single PI+cells (Q1 areas) (E) and Annexin V+cells (Q2 and Q3 areas) (F) in each group. G Western blot of GAPDH, BAX, BCL-2, and Cleaved-caspase-3 expression. H mRNA expression of RIPK1 and RIPK3.HepG2 and HuH7 cells incubated with NAC(5 mM) at 12 h after sublethal heat stress. (I)Cell death was quantified using Annexin V-FITC/PI staining and flow cytometry at 24 h after sublethal heat stress. Values are the mean±SE.**p<0.01; ***p<0.001; ns no significance

Enhanced production of mtROS driven by NADPH oxidase

ROS can be generated in various cellular compartments, and they have different reactivities and stabilities. Mitochondria and cellular NADPH oxidase are the two main sources of cellular ROS [16]. To investigate the source of increased ROS production, mitochondrial superoxide production was assayed using MitoSOX™ staining, and NADPH oxidase activity was measured by the lucigenin-enhanced chemiluminescence method. As shown in Fig. 3A, mtROS levels gradually increased from 2 to 6 h after sublethal heat stress, then gradually decreased, and were finally maintained at a level higher than that observed at 37. NADPH oxidase activity also increased from 2 h after sublethal heat stress (Fig. 3B). Furthermore, both pharmacological inhibition of NADPH oxidase with DPI or VAS2870 and cleavage of mtROS with mitoTEMPO induced apoptosis and reduced the ROS levels after sublethal heat stress (Fig. 3C, D). This suggests that both sources contributed to the increased generation of ROS and cell survival after sublethal heat stress. Notably, the level of ROS reduction by NAC, a nonspecific ROS scavenger, was not more pronounced than that by mitoTEMPO, DPI, or VAS2870 (Fig. 3D). There may be an upstream and downstream relationship between mitochondria and NADPH oxidase. Reports suggest that NADPH oxidase is also located within mitochondria and induces mtROS release by generating ROS [29, 39, 40]. Therefore, we further investigated the effect of NADPH oxidase inhibition on mtROS generation. As shown in Fig. 3E, inhibition of NADPH oxidase by DPI or VAS2870 inhibited mtROS levels at 6 h after sublethal heat stress. Thus, NADPH oxidase is upstream of mtROS generation after sublethal heat stress.

Open in a separate window

Fig. 3

Elevated production of mitochondrial ROS driven by NADPH oxidases. A Changes in MitoSOX™ fluorescence as measured using flow cytometry at the indicated time points (37 °C, 0, 2, 6, 12, and 24 h) after sublethal heat stress.B Superoxide production by NADPH oxidase was measured in total cell homogenates. C Heated or unheated HCC cells incubated with or without inhibitors of ROS: NAC(5 mM), MitoTEMPO (500 nM), DPI (10 μM), or VAS2870 (10 μM). Apoptosis was quantified using Annexin V-FITC/PI staining and flow cytometry at 24 h after sublethal heat stress. D ROS levels as measured by flow cytometry at 6 h after sublethal heat stress. E Heated or unheated HCC cells preincubated with or without inhibitors of NADPH oxidase: DPI (10 μM) and VAS2870 (10 μM), MitoSOX™ fluorescence as measured using flow cytometry at 6 h after sublethal heat stress. Values are the mean±SE.**p<0.01 vs. 37; ***p<0.001 vs. 37; ###p<0.001 vs. 6 h; ns no significance

The upregulation of NOX4 in mitochondria contributes to the increase in ROS production after sublethal heat stress

The NOX family contains seven members, and the mRNA expression of these genes was determined. The results showed that only NOX4 mRNA expression was significantly upregulated at 6 h after sublethal heat stress (Fig. 4A). Western blotting analysis also revealed that NOX4 protein expression was markedly increased in both cell types after sublethal heat stress (Fig. 4B). Studies have reported that NOX4 is located in mitochondria and is associated with the generation of mtROS in both breast cancer cells and renal cells [29, 41]. Therefore, we further investigated whether NOX4 is located in the mitochondria of HepG2 and HuH7 cells by using confocal microscopy. The overlap of NOX4 staining and MitoTracker™ red staining suggested that NOX4 localized at mitochondria in both HepG2 and HuH7 cells (Fig. 4C). To further verify this hypothesis, we measured NOX4 expression in the mitochondrial fractions of HepG2 and HuH7 cells by Western blotting. The results confirmed that NOX4 was located in the mitochondria, and its level was also increased in this compartment after sublethal heat stress (Fig. 4D). We then used siRNA-mediated knockdown of NOX4 to investigate its function (Fig. 4E). This approach was also successful in reducing mitochondrial NOX4 expression (Fig. 4F). Consistent with the pharmacological inhibition of NADPH oxidase, the knockdown of NOX4 significantly suppressed both total ROS and mtROS production at 6 h after sublethal heat stress (Fig. 4G, H). As expected, inhibition of NOX4 also increased apoptosis at 24 h after sublethal heat stress (Fig. 4I, J). These results suggest that upregulation of NOX4 in mitochondria is the trigger of increased mtROS generation after sublethal heat stress.

Open in a separate window

Fig. 4

NOX4 localizes at mitochondria and contributes to the increase in ROS production after sublethal heat stress. A RT-qPCR analysis of NOX1–5 and DUOX1–2 mRNAs expression after sublethal heat stress. B Western blot of NOX4 expression in total cell lysates after sublethal heat stress. C Colocalization of mitochondria and NOX4. MitoTracker™ red and FITC- conjugated secondary antibody was used for NOX4. Nuclei were counterstained with Hoechst 33,342. Yellow displays colocalization. D Western blot of NOX4 expression in mitochondria after sublethal heat stress. E Protein levels of NOX4 in whole cell extracts. F Protein levels of NOX4 in mitochondria. G DCFH-DA and H MitoSOX™ fluorescence as measured using flow cytometry at 6 h after sublethal heat stress.I and J Apoptosis was quantified using Annexin V-FITC/PI staining and flow cytometry at 24 h after sublethal heat stress. Values are the mean±SE. *p<0.05;***p<0.001; ns no significance

Inhibition of ROS levels after sublethal heat stress induces the accumulation of damaged mitochondria and results in severe mitochondrial dysfunction

Short-term heat exposure can cause damage to the mitochondria [26]. Removal of damaged mitochondria by autophagy is an essential survival response. ROS are known to trigger both autophagy and, mitophay and may be essential for removing damaged mitochondria after sublethal heat stress. We first assessed the content of mtDNA,a biochemical marker of mitochondrial number that is affected by inhibition of ROS after sublethal heat stress. The results showed that NAC treatment after sublethal heat stress increased the mtDNA copy number (Fig. 5A). Then, we further investigated the effect of inhibiting ROS production on removing damaged mitochondria using a fluorescence-based assay. As shown in Fig. 5B, the accumulation of damaged mitochondria was observed in the NAC treatment group after sublethal heat stress(Fig. 5B, C). Then, the morphology, quantity, and function of mitochondria were assessed. As shown in Fig. 5D, the NAC treatment group showed more round mitochondrial structures. Increased mitochondrial mass and reduced ATP production were also observed in the NAC treatment group (Fig. 5E, F). Basel respiration, max respiration, ATP-coupled oxygen consumption and proton leak were significantly decreased in cells by NAC treatment after sublethal heat stress(Fig. 5G). These results suggest that the ROS burst after sublethal heat stress is necessary to remove damaged mitochondria and sustain mitochondrial function.

Open in a separate window

Fig. 5

Inhibition of ROS production results in accumulation of damaged mitochondria and severe mitochondrial dysfunction after sublethal heat stress. A The mitochondrial DNA copies of each group. B Flow cytometry of mitochondrial status. Gates represent cells with damaged mitochondria. C The statistical results of B in three independent experiments. D Representative images of mitochondrial morphology. E Mitochondrial as mass assessed by staining with MitoTracker™ Green using a flow cytometric. F ATP contents of each group. G Results of the Mito stress test. Values are the mean±SE.*p<0.05;**p<0.01; ***p<0.001; ns no significance

Mitophagy is induced by sublethal heat stress and is involved in survival

Mitophagy is a type of selective autophagy that mediates the clearance of damaged or dysfunctional mitochondria from the cell. ROS can induce the induction of PINK1-dependent mitophagy. It is unclear whether mitophagy plays a role in cell survival during heat stress. To determine whether mitophagy can be induced by sublethal heat stress, we assessed the LC3B, PINK1, P62, and TOMM20 protein levels via Western blotting. As shown in Fig. 6A, cells exposed to sublethal heat stress showed significantly increased protein expression levels of LC3B-II and PINK1, accompanied by significantly reduced P62 and TOMM20 protein levels. To further verify the induction of mitophagy by sublethal heat stress, we assessed mitophagy after sublethal heat stress based on the colocalization of labeled mitochondria and lysosomes. The results showed that sublethal heat stress exposure caused significant increase in the colocalization of mitochondria and lysosomes (Fig. 6B). This suggests that mitophagy was activated by sublethal heat stress in cells. Therefore, we further investigated whether mitophagy is involved in cell survival after sublethal heat stress. We pretreated cells with FCCP, an inducer of mitophagy, and Mdivi-1,an inhibitor of mitophagy, to observe the changes in apoptosis after sublethal heat stress. As shown in Fig. 6C, inhibition of mitophagy resulted in a 1.5-to 2.5-fold increase in Annexin V+staining, and inducing mitophagy before sublethal heat stress significantly inhibited apoptosis. This confirmed that mitophagy exerts a pro-survival effect after sublethal heat stress.

Open in a separate window

Fig. 6

Mitophagy is induced by sublethal heat stress and is involved in survival. A WB of GAPDH, P62, LC3B, and TOMM20. B Representative confocal images of cells coloaded with MitoTracker™ Red and LysoTracker™ Green at 24 h after sublethal heat stress. Colocalization is shown in yellow and indicated by arrows. C Flow cytometry analysis of apoptosis of heated or unheated HCC cells after inducing or inhibiting mitophagy at 24 h after sublethal heat stress. Values are the mean±SE.**p<0.01; ***p<0.001; ns no significance

Inhibition of ROS production induces apoptosis after sublethal heat stress by inhibiting mitophagy

To determine whether the apoptosis induced by ROS inhibition was mediated by mitophagy, we examined alterations in LC3B-II, PINK1, P62, and TOMM20 protein levels in cells following inhibition of ROS production after sublethal heat stress. As shown in Fig. 7A, decreased PINK1 and LC3B-II protein expression, and P62 and TOMM20 accumulation were observed upon inhibition of ROS production after sublethal heat stress. Moreover, the colocalization between mitochondria and lysosomes was also markedly decreased in the group treated with NAC (Fig. 7B). To further confirm, we examined the impact of the preinduced of mitophagy on NAC induced apoptosis after sublethal heat stress. As shown in Fig. 7C, the effect of NAC on inducing apoptosis after sublethal heat stress was completely eliminated by the predinduction of mitophagy. These data confirmed that mitophagy was suppressed by inhibition of ROS production after sublethal heat stress.

Open in a separate window

Fig. 7

Inhibition of ROS production induces apoptosis after iRFA via mitophagy inhibition. A WB of GAPDH, P62, LC3B, and TOMM20 expression in heated or unheated HCC cells treated with or without 5 mM NAC at 24 h after sublethal heat stress (B) Representative confocal images of cells coloaded with MitoTracker™ Red and LysoTracker™ green after ROS inhibition. Colocalization is shown in yellow and indicated by arrows. C Apoptosis was quantified using Annexin V-FITC/PI staining and flow cytometry of heated cells treated with NAC (5 mM) or FCCP (1 μM) at 24 h after sublethal heat stress. Values are the mean±SE. ***p<0.001; ns no significance

Nrf2 was elevated in response to oxidative stress after sublethal heat stress and mediated ROS induced mitophagy

Nrf2 is usually activated to promote tumor cell survival under oxidative stress conditions[42].To determine whether the oxidative stress induced by acute sublethal heat stress is sufficient to activate Nrf2, we measured the change in Nrf2 by Western blotting. As shown in Fig. 8A, elevated Nrf2 protein expression was observed after sublethal heat stress and was accompanied by decreased Keap1 expression. Nrf2 is a transcription factor that performs its function in the nucleus. Thus, we futher measured the nuclear protein expression of Nrf2. Increased protein expression of Nrf2 was also observed in the nucleus after sublethal heat stress(Fig. 8B). This was also confirmed by immunofluorescence (Fig. 8C). To determine whether this elevated Nrf2 expression was a responsed to the ROS burst that occurs after sublethal heat stress, we examined the effect of NAC on the protein expression of Nrf2. As shown in Fig. 8C, D, the expression of Nrf2 was significantly inhibited by NAC treatment after sublethal heat stress. We further measured the effect of adding NAC 12 h after sublethal heat stress on the protein expression of Nrf2, since the oxidative stress was confined to within 12 h after sublethal heat stress. The results showed that there was no effect on the protein expression of Nrf2 when NAC was added at 12 h after sublethal heat stress(Fig. 8E). This confirmed that the Nrf2 elevation occurred in response to the ROS burst that occurs after sublethal heat stress. Reports also suggest that Nrf2 can induce PINK1 expression during stress. Thus, we further explored the effect of Nrf2 on the protein expression of PINK1. As shown in Fig. 8F, the NAC-mediated inhibition of PINK1 expression after sublethal heat stress could be reversed by bardoxolone, an activator of Nrf2 (Fig. 8F). Similarly, the apoptosis induced by NAC after sublethal heat stress was also reversed by bardoxolone(Fig. 8G). Taken together, under sublethal heat stress, Nrf2 expression was increased in response to the ROS burst, and then it translocated to the nucleus to induce the expression of PINK1, which is involved in to involve the mitophagy after sublethal heat stress.

Open in a separate window

Fig. 8

Nrf2 was elevated in response to oxidative stress after sublethal heat stress and mediated ROS induced mitophagy. A Western blot of Keap1 and Nrf2 expression in whole cell lysates. B Changes in the protein expression of Nrf2 in nucleus. C Representative image of Nrf2 localization in cells in different groups.DEffect of NAC(5 mM) on Nrf2 E Effect of adding NAC(5 mM) 12 h after sublethal heat stress on Nrf2. F Inhibition effect of NAC on PINK1 after sublethal heat stress was reversed by bardoxolone. G Apoptosis induced by NAC after sublethal heat stress was reversed by bardoxolone at 24 h after sublethal heat stress

Not applicable.