Opsonic Activity of Ab Raised to S. aureus PNAG Glycoforms Against Clinical Isolates of E. coli.

Fig. 2 presents the opsonic killing activity against 4 different E. coli clinical isolates using dilutions of rabbit polyclonal antibodies raised to either a poorly acetylated glycoform of PNAG designated dPNAG (deacetylated PNAG) or raised to highly acetylated (>95% substitution) native PNAG. Prior results with Staphylococcus showed that antibodies raised to dPNAG had superior opsonic killing activity and protective efficacy in animals (14). Although many E. coli strains can be killed in a bactericidal assay using only Ab to capsular polysaccharides and complement, we found that after absorption of the complement source with E. coli cells to remove any antibody from this reagent, the Ab to PNAG could not mediate bacterial killing in the absence of phagocytes. For all 4 of the strains at essentially all of the serum dilutions tested, dPNAG Ab mediated superior opsonic killing compared with Ab raised to native PNAG. Thus, as we found for S. aureus (14), Ab raised to the dPNAG antigen mediated better killing than Ab raised to then native PNAG antigen. Superior opsonic killing activity correlates with a better ability to deposit opsonically active fragments of the third component of complement on the bacterial surface (22).

Open in a separate window

Fig. 2.

Opsonophagocytic killing activity of goat Ab raised to either dPNAG (black diamonds) or PNAG (gray squares) against E. coli strains UTI-J, UTI-P, UTI-U, and NICU10. Points represent means of triplicates; SE bars are <5% and are contained within each point.

When we evaluated the opsonic killing of the 30 E. coli clinical isolates by the rabbit polyclonal Ab raised to dPNAG, we found that 9 of the pga-positive strains were poorly killed in vitro (<10%), 5 (all UTI isolates) were modestly killed (11–30%) and 16 were killed fairly well (>30%) (Fig. 3). Results are also summarized in Table 1. None of the E. coli strains lacking the pga locus was killed >10%. Several of the strains (indicated on the graph in Fig. 3) were then used in protection studies.

Open in a separate window

Fig. 3.

Opsonophagocytosis of the E. coli clinical isolates. Circles, UTI isolates. Squares, isolates from neonates in the NICU. A symbol indicates mean of triplicates, error bars the SD. Six isolates used in the protection studies are noted, as is E. coli UTI-JΔpga, for which only background levels of killing of were achieved. UTI strain H lacks the pga locus.

The specificity for the PNAG antigen of the opsonically active Ab in antisera raised to dPNAG conjugated to diphtheria toxin (dPNAG-DT) was shown by the loss of killing activity in the immune sera, initially diluted to have 40–70% killing activity, after adsorption with E. coli J. When the sera were adsorbed with the Δpga strain, no diminution in opsonic killing was observed [supporting information (SI) Fig. 4].

Construction of E. coli pga-Deleted and Complemented Strains.

The pga locus was replaced with a chloramphenicol acetyltransferase cassette by the PCR-mediated one-step method of gene inactivation described by Datsenko and Wanner (41). To accomplish this goal, E. coli BW25113 and the clinical UTI isolate strain J were first transformed with the red recombinase expression plasmid pKD46 then grown overnight at 25°C in SOC medium (2 × 10⁻² g/ml Bacto-tryptone/5 × 10⁻³ g/ml yeast extract/5.84 × 10⁻⁴ g/ml NaCl/1.86 × 10⁻⁴ g/ml KCl/20 mM MgCl₂/20 mM Glc, pH 7.0) containing 100 μg of ampicillin per ml and 10 mM l-arabinose. The next day, the cells were collected by centrifugation, washed three times with deionized H₂O containing 10% glycerol, and resuspended at a 50-fold concentration over the original volume. A PCR product of the chloramphenicol acetyltransferase cassette was generated from plasmid pKD3 by using the primer pair pgadeleteFWD (5′-CCGGACTAGCGCTTTTTCTGAAACCACCATTTTTATTTGCCCCT G G C T G G GTGTAGGCTGGAGCTGCTTC-3′) and pgadeleteREV (5′-AAGTAGCAGAAAAAGGTGCCCGAAAACCAA A T G GGCTTTGAAACTTCTTACATATGAATATCC T C C TTAG-3′). The PCR product had 5′ and 3′ ends homologous to the 5′ and 3′ ends of the E. coli pga locus and was gel-purified by using the QIAquick gel extraction kit (Qiagen, Valencia, CA). Electrocompetent E. coli cells were transformed with the purified PCR product by electroporation, and transformants were selected on LB agar containing 30 μg of chloramphenicol per ml. Chloramphenicol-resistant bacteria were analyzed by PCR to ascertain that the chromosomal pga locus was deleted (Δpga strains) and were then cured of the pKD46 plasmid by two rounds of growth at 42°C in the absence of ampicillin. The E. coli BW25113 parental and Δpga strains were used to confirm the specificity of the immunoblot, and the Δpga strain was used to absorb antisera used in the opsonic killing assay.

To transcomplement the pga-deletion mutants, the entire pga locus was amplified from E. coli BW25311 DNA by PCR using primers pgaexpressFWD (5′-ATGTATTCAAGTAGCAGAAAAAGGTGC-3′) and pgaexpressREV (5′-GTGTTTACGCCCGGACTAGC-3′) and cloned into the arabinose-inducible pBAD-TOPO vector (Invitrogen, Carlsbad, CA). The DNA sequence of the insert in the resulting construct, pPGA, was determined to confirm identity to the known pga DNA sequence and then used to transform the pga-deletion mutant strains by electroporation. Transformants were selected on LB agar containing 100 μg ampicillin per ml. Addition of arabinose to the growth medium was not necessary for sufficient expression levels in pPGA-complemented strains.

Detection of PNAG Production by Bacteria.

Immunoblots for production of PNAG were performed essentially as described previously (7, 42) with minor modifications. Bacteria were grown to stationary phase in TSBG, and the cultures were diluted in this growth medium to produce an A₆₀₀ = 1.5. Bacterial cells were pelleted by centrifugation, and equivalent amounts of each of the different bacterial preparations were resuspended in 300 μl of 0.5 M EDTA (pH 8.0) and incubated for 5 min at 100°C. Cells were removed by centrifugation at 10,500 × g for 6 min, and 100 μl of the supernatant was then incubated with 10 μl of proteinase K (20 mg/ml; Qiagen) for 60 min at 60°C. Proteinase K was heat-inactivated by incubating for 30 min at 80°C. This solution was diluted 3-fold in Tris-buffered saline (20 mM Tris·HCl/150 mM NaCl, pH 7.4), except for the extract from S. epidermidis M187, which was diluted 1,000-fold because of hyperproduction of PNAG by this strain, and 200 μl of each dilution was immobilized on a nitrocellulose filter attached to a slot-blot vacuum manifold. The filter was blocked with a solution of 1% BSA, then incubated for 2 h with a rabbit Ab raised to S. aureus PNAG conjugated to DT, produced as described previously (14) and further purified on an affinity column, also as described previously (22). The secondary Ab used was a horseradish peroxidase-conjugated anti-rabbit IgG Ab (Southern Biotech, Birmingham, AL) diluted 1:6,000, and detection of the PNAG antigen used the enhanced chemiluminescence (Amersham, Piscataway, NJ) Western blotting system.

Detection of the pga Locus in E. coli Clinical Isolates by PCR.

Genomic DNA from E. coli strains was extracted by using a DNeasy tissue kit (Qiagen). Primers used for the detection of the pgaA (5′-GGCTTTGAAACTTCTTACTGC-3′ and 5′-CCTGTTTATCTTGCCCGGCC-3′) and pgaC (5′-ATGATTAATCGCATCGTATCG-3′ and 5′-CATCGGTTCCACAATATATGC-3′) were custom synthesized by Qiagen Operon (Alameda, CA). For the PCR we added 25 μl of PCR supermix high-fidelity (Invitrogen), 0.5 μl of each primer, and 2 μl of DNA from the bacterial strains. PCR conditions comprised an initial 5-min denaturation step at 94°C followed by 32 cycles of 30 s at 94°C, 30 s at 50°C, and 45 s at 72°C, and a final extension step of 5 min at 72°C.

Antisera.

We used antibodies raised to either native S. aureus PNAG, wherein the glucosamine monosaccharides contained ≈95% acetate groups, or dPNAG, wherein the level of substitution with acetate groups was ≈15% (29). Both polysaccharides were conjugated to DT as described (14) and used to raise antibodies in rabbits, also as described previously (14). The dPNAG-DT conjugate was also used to immunize a goat as described previously (20). Specificity of the rabbit antiserum used in the opsonophagocytic assay was evaluated by adsorbing the sera with either PNAG-expressing E. coli J or the isogenic PNAG-negative E. coli Δpga strain. Specificity of the goat antisera for PNAG expression by E. coli was evaluated by whole-cell ELISA using the E. coli J and JΔpga strains. For some control experiments, we used a goat antiserum to human IgG raised by using the same adjuvants and immunization schedule as was used for the dPNAG-DT conjugate vaccine and was supplied by Lampire Biological Laboratories, Pipersville, PA. We have shown previously that the goat antiserum has comparable binding and opsonic activity against PNAG-producing S. aureus as does the rabbit antiserum raised to the dPNAG-DT conjugate (14).

Opsonic Killing of E. coli Clinical Isolates.

WBC were prepared from fresh human blood collected from healthy adult volunteers. Twenty-five milliliters was mixed with an equal volume of dextran/heparin buffer and incubated at 37°C for 1 h. The upper layer containing the leukocytes was collected, the cells were pelleted by centrifugation, and the remaining erythrocytes were removed by hypotonic lysis after resuspension of the cell pellet in 1% NH₄Cl with incubation for 10 min at room temperature. WBC were then washed three times and resuspended with RPMI containing 15% heat-inactivated (56°C, 30 min) FBS (RPMI/FBS). Trypan blue staining was used to determine the number of viable leukocytes, then the final WBC count was adjusted to 2.5 × 10⁷ WBC per ml. The complement source (1 ml of baby rabbit serum diluted 1:10 in RPMI/FBS) was adsorbed twice at 4°C for 45 min with continual mixing using bacteria resuspended from a pellet containing ≈10⁹ cfu of E. coli BW25113 to remove natural Ab that mediated bactericidal killing of some of the target E. coli strains. The rabbit antisera were diluted 1:10 in RPMI/FBS and absorbed twice at 4°C for 45 min with continual mixing using bacteria resuspended from a pellet containing ≈10⁹ cfu of E. coli BW25113Δpga. After absorption, the complement solution and the Ab were centrifuged and filter-sterilized. The bacterial strains to be evaluated for phagocyte-dependent killing activity of the rabbit Ab to PNAG were grown overnight in TSBG and then adjusted to an A₆₅₀ = 0.4. A 1:100 dilution (3–6 × 10⁷ cfu/ml) was then made in RPMI/FBS for use in the killing assay.

The opsonophagocytic assay was performed with 100 μl of leukocytes/100 μl of bacteria/100 μl of the complement solution/100 μl of a 1:10 or higher dilution of the Ab. Several controls were used: each component individually and all of the possible combinations of the individual components with one missing. The missing volume was made up with 100 μl of RPMI/FBS. The reaction mixture was incubated on a rotor rack at 37°C for 90 min. The tubes were vortexed for 15 s, and then dilutions were made in TSB with 0.025% Tween (to prevent bacterial sticking to pipette tips and the walls of dilution vessels); samples were than plated onto tryptic soy agar plates. The percentage of killing was calculated by determining the ratio of the cfu surviving in the tubes with bacteria, leukocytes, complement and Ab, to the cfu surviving in the tubes with bacteria, complement, leukocytes, and RPMI/FBS. Each assay was done in triplicate and repeated two or three times.

Murine Lethality Model.

To evaluate the in vivo protective efficacy of Ab to PNAG, we used an i.p. infection model in mice, as described previously (8, 14). Briefly, groups of eight mice (FVB, female, 6–8 weeks of age) were immunized i.p. 24 h before and 4 h after infection with 0.3 ml of normal goat serum or immune goat serum raised against staphylococcal dPNAG conjugated to DT. Some mice received a heterologous immune serum raised to human IgG with the same adjuvants and schedule as used with the dPNAG-DT conjugate. Bacteria were grown overnight in TSBG and then resuspended in sterile PBS to ≈5 × 10⁸ to 5 × 10⁹ cfu/ml, depending on the strain. For each strain, we selected a minimal dose that would kill at least 75% of the mice. Mice were challenged i.p. with a dose of 1.25 × 10⁸ to 1 × 10⁹ cfu in 0.2 ml of PBS and monitored at least twice daily. When mice became moribund, as defined by hunched appearance, markedly increased respiration rate, piloerection, and lack of an ability to move in response to being touched, they were considered moribund; they were killed and counted as dead for these experimental outcomes. After death, the spleens of the mice were removed, homogenized in RPMI, and cultured on tryptic soy agar and MacConkey agar to determine that the E. coli had disseminated from the initial site of infection.

This work was supported by National Institutes of Health Grants AI46706 (to G.B.P.) and R21AI61590 (to K.K.J.). N.C. was supported by Portuguese Fundação para a Ciência e Tecnologia Grant SFRH/BD/8676/2002 and by the Portuguese Fulbright Commission.