Preparation of P. aeruginosa chromosomal DNA for the construction of libraries and Southern blot analyses.

A 20-ml overnight culture from a single colony was centrifuged at 1,700 × g for 10 minutes; the pellet was then washed with an equal volume of 0.85% NaCl followed by a second wash with TES (10 mM Tris-HCl, 25 mM EDTA, 150 mM NaCl [pH 8.0]). The bacteria were suspended in 10 ml of TE (10 mM Tris-HCl, 25 mM EDTA). Then, 0.5 ml of 20% sodium dodecyl sulfate was added to the suspension and the cells were incubated at 37°C for a few minutes until the suspension cleared. The lysate was extracted with Tris-buffered phenol (pH 8.0), followed by Tris-buffered phenol-chloroform. The DNA in the aqueous phase was precipitated with 1/10 volume of 3 M sodium acetate (pH 4.8) and 2 volumes of ethanol. The DNA was spooled out with a glass rod, rinsed with 1 ml of 70% ethanol, air dried, and then resuspended in TE containing 20 μg of RNase per ml.

Construction of an M13 library of P. aeruginosa chromosomal DNA fragments.

Approximately 100 μl of chromosomal DNA was sheared for 5 s on a W380 sonicator (Ultrasonics, Inc.) using the following settings: duty cycle, 68%; output control, 41/2 position; cycle time, continuous. The sonicated DNA was repaired by T4 DNA polymerase (Boehringer Mannheim) in 20 μl of 5× buffer, 2 μl of 10 mM deoxynucleotide triphosphate, 3 μl of T4 DNA polymerase (10 U/μl), and 75 μl of sonicated DNA solution at 37°C for 1 h. The blunt-ended DNA was size fractionated by agarose gel electrophoresis. Fragments between 1.5 and 3.0 kb were recovered using a gel extraction kit (Qiagen). The fragments were treated with T4 DNA polymerase and purified using the PCR product purification kit (Qiagen). The DNA concentration was determined spectrophotometrically and adjusted to 50 ng/μl. The ligation mixture (10 μl) consisted of 50 ng of the P. aeruginosa DNA, 50 ng of M13mp18 replicative-form DNA which had been predigested with SmaI and dephosphorylated (Novagen), and 200 U of T4 DNA ligase (New England Biolabs) and was incubated at room temperature overnight. Aliquots of this ligation mixture were used to transform E. coli TG1 and plated in soft agar, overlaid on L-agar, plates containing X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) as described by Sambrook et al. (21). White plaques were recovered following overnight incubation at 37°C.

Preparation of the arrays for differential genomic DNA hybridization.

White plaques from the M13 library plates were inoculated into 1 ml of a suspension of E. coli TG1 cells (grown overnight and resuspended 1:200 in LB medium) in 96-well plates (Beckman) containing two 3-mm glass beads (VWR Scientific). The plates were covered with sterile filter paper and incubated 12 to 14 h with shaking at 37°C. The following day, the plates were centrifuged at 1,700 × g for 30 min and 100 μl of the phage-containing supernatant was transferred to polypropylene microtiter plates.

A 96-pin metal spotting device (Nalgene/Nunc) was used to spot aliquots of the M13 phage mixture in duplicate onto two sets of 7.9- by 11-cm nylon membrane sheets (Hybond-N+; Amersham). The sheets were treated by sequential 5-min exposure to filter paper saturated with a solution of 1.5 M NaCl–0.5 M NaOH, followed by a neutralization step on sheets impregnated with 1.5 M NaCl–0.5 M Tris-HCl (pH 7.5). The nylon sheets were then rinsed in 5× SSC (20× SSC is 0.3 M sodium citrate and 3 M NaCl), air dried, baked at 80°C for 2 h, and soaked in 5× SSC prior to hybridization. Chromosomal DNA probes were prepared by sonication of total DNA from PAO1 and from the UTI strain X24509, followed by purification using a PCR purification kit (Qiagen). This DNA was labeled with a Gene Image random primer labeling kit (Amersham). The filters were hybridized with the probes and detected using the instructions and conditions provided by the manufacturer except that the washing temperature was increased to 62°C. One set of the membranes was hybridized with the PAO1 chromosomal DNA probe, while the other set was hybridized with the X24509 chromosomal DNA probe. M13 clones which were positive for the X24509 probe hybridization but negative for PAO1 probe hybridization were recovered and used as templates for DNA sequencing of the inserts. To assess the distribution of the insert sequences among different P. aeruginosa isolates, M13 clones that did not react with the PAO1 probe were rearrayed on fresh nylon sheets and probed with labeled chromosomal DNA from 19 different P. aeruginosa strains.

Construction and screening of a cosmid library of P. aeruginosa X24509.

The large insert DNA fragments were prepared by limited digestion of purified X24509 chromosomal DNA with 0.8 U of Sau3A (New England Biolabs) in a 100-μl volume at 37°C for 1 h. The enzyme was inactivated by heat treatment at 67°C for 10 min. The DNA was extracted with 1 volume of phenol-chloroform (1 volume/1 volume) followed by ethanol precipitation. The DNA fragments were resuspended in 80 μl of water and dephosphorylated with 10 U of calf intestinal alkaline phosphatase (Promega) at 37°C for 1 h. The phosphatase was heat inactivated and extracted with phenol-chloroform, and the DNA was precipitated with ethanol. Vector DNA (Super-Cos-DBI) was digested with BamHI, dephosphorylated, and purified as described for the preparation of chromosomal insert DNA. Ligation was performed in a total volume of 10 μl containing 5 μg of insert DNA, 1 μg of vector DNA, and 200 U of T4 DNA ligase at room temperature overnight. Packaging into lambda particles and recovery of cosmid clones was done as described in the protocol provided by the supplier of the packaging extracts (Stratagene). Clones were grown in 96-well plates, and following addition of glycerol to 25%, they were stored frozen at −80°C. The library consisted of a total of 19 copies each of 96 individual cosmid clones. For hybridization with labeled DNA probes, aliquots of the library were spotted onto nylon membranes with a 96-pin spotting tool and hybridized with specific DNA probes derived from selected M13 clones that contained X24509-specific segments.

Sequencing of M13 clones and cosmids.

Single-stranded DNA for a small number of M13 clones were prepared as described by Sambrook et al. (21). One end of the single-stranded DNA was sequenced with the reverse primer GTTTTCCCAGTCACGACGTTG. The other ends of some clones were sequenced by first PCR amplifying the entire M13 insert and then sequencing the product with the forward primer CAGCTATGACCATGATTACG. The cosmids were propagated in E. coli DH5α and were purified using the Qiagen midiprep kit. Ends of the cosmids were sequenced with the T3′ primer GGCGTATCACGAGGCCCTTTC and the T7′ primer CGATGATAAGCGGTCAAAC. The DNA sequence of the entire cosmid was determined following the construction of an M13 library using sonicated DNA as described for the construction of the M13 library from chromosomal DNA. The individual reads from the shotgun sequencing of the M13 clones were assembled into contigs using the base-caller program Phred and the assembly program Phrap (7).

Distribution of X24509 DNA segments among different P. aeruginosa isolates.

In order to assess whether any of the X24509 segments that were identified by differential genomic DNA hybridization are present in other P. aeruginosa strains, the 54 M13 clones of genes present in X24509 were arrayed, in multiple copies, onto nylon sheets and probed with labeled chromosomal DNA from a collection of P. aeruginosa strains. A total of 18 different probes were used, representing six UTI isolates, six blood isolates, and six strains obtained from patients with cystic fibrosis. The arrays were also probed with a PAO1 probe. The summary of the hybridization results is shown in Table ​Table3.3. Certain M13 clones reacted only with the X24509 probe, and they include LX4, LX19, LX26, LX42, LX49, LX64, and LX67. Based on our limited survey, these are X24509-specific segments that are not present in any other isolates. Clones LX12, LX29, LX30, LX31, LX32, LX39, LX51, LX53, LX57, and LX68 reacted weakly with the PAO1 chromosomal probe. All but one very likely contain homologous sequences from PAO1 at one end of the insert. Clone LX32 carries the portion of the pilB and pilC chromosomal segment, and the weak hybridization of the PAO1 probe is almost certainly due to the polymorphic pilC gene. Finally, certain M13 clones (LX24, LX40, LX41, and LX46) reacted with the majority of probes from clinical strains. This group of M13 clones was then used to identify the contiguous regions in the P. aeruginosa X24509 chromosome in cosmid clones.

Cloning and sequencing of the pathogen-associated DNA from P. aeruginosa.

A cosmid library containing chromosomal segments of P. aeruginosa X24509 was prepared, and it was analyzed using DNA probes generated by PCR amplification of inserts in M13 clones LX24, LX40, LX41, and LX46. All of the probes identified the same four cosmids, indicating that the probes were derived from a single contiguous region of the X24509 chromosome. The sequence of the ends of four cosmid clones (pDX4E8, pDX9F8, pDX11G5, and pDX11E6) was obtained using the primers T3′ and T7′, which flank the cloning site of the vector. The alignment of the cosmids and the location of the four M13 clones used for screening of the cosmid library is shown in Fig. ​Fig.2.2. The T7 end of the insert in cosmid pDX4E8 showed identity to the sequence of the PAO1 genome (http://www.pseudomonas.com/; release date, 15 December 1999) increasing from bp 2438028, while the sequence obtained from the T3 end was unique. The T7 end of cosmid DX9F8 is identical to the PAO1 sequence, increasing from bp 2437159, and the T3 end is unique. This indicates that the T7 ends of the inserts in both DX9E8 and DX4F8 end within the same region with a difference of ca. 900 bp. For the insert in cosmid pDX11E6, its T3 end is identical to the PAO1 sequence, decreasing from bp 2456045, and its T7 end is a previously unknown sequence. For pDX11G5, its T3 end was a unique sequence, but its T7 end is identical to the PAO1 sequence, decreasing from bp 5263148. The discrepancies of the similar location of the ends of cosmids pDX4F8, pDX9E8, and pDX11E6 and the distal location of pDX11G5, relative to the PAO1 genome, were resolved during sequencing of the cosmids (see below).

Open in a separate window

FIG. 2

Overlap of four cosmids that contain the X24509 genomic island PAGI-1. The cross-hatched regions indicate the junction sequences that are also present in PAO1. The left-hatched regions represent PAGI-1 sequences. The black boxes represent regions containing sequences with high degrees of similarity to a region in the PAO1 genome. The right-hatched boxes indicate the locations of the sequences of the M13 clones that were used to screen the X24509 cosmid library. Also indicated are the locations of the junction sequences in PAGI-1 and the sequences in the X24509 genome, with corresponding coordinates of the genome of strains PAO1. The locations of the T3 and T7 sites in the cosmid vector, used for sequencing, are also shown.

The sequence of cosmids pDX4F8 and pDX11E6 was determined by a shotgun approach, following preparation of random M13 libraries and obtaining single sequence reads from ca. 1,200 M13 clones. Given an average read length of 500 bp, approximately 600 kb of unique reads were generated, representing a 10-fold coverage of the sequenced DNA estimated to be ca. 60 kb in size. The final contig was 60,180 bp in size from the T7 end of cosmid pDX4F8 to the T3 end of cosmid pDX11E6. The BLAST search of the contig against the PAO1 genome sequence revealed that both ends of the contig contain sequences identical to that of PAO1. The X24509-specific region designated PAGI-1 (for “P. aeruginosa genomic island 1”, which is absent from PAO1, starts at 925 bp and ends at 49,818 bp of the assembled contig. The length of the island sequence is therefore 48,893 bp. The island sequence flanked by junction sequences, i.e., those identical to the PAO1 sequences (1,575 bp on the left and 833 on the right), which correspond to the sequences present in the PAO1 genome was submitted to the gene bank of NCBI. Cosmid pDX11E6 contains bp 12311 to 48893 of PAGI-1, pDX11G5 contains bp 801 to 43891 of PAGI-1, pDX4F8 contains bp 1 to 43474 of PAGI-1, and pDX9E8 contains bp 1 to 48820 of PAGI-1. The locations of the M13 inserts that identified the island, relative to the PAGI-1 sequence, are as follows: LX24 is located at bp 25502 to 29068 of PAGI-1, LX40 is at bp 24392 to 26315 of PAGI-1, LX41 is at bp 21478 to 23497 of PAGI-1, and LX46 is at bp 20192 to 21236 of PAGI-1.

Although both ends of PAGI-1 connect with PAO1 sequence from the same region, these sequences are not contiguous in PAO1. The left end of PAGI-1 was contiguous with the PAO1 genome sequence at bp 2438952, while the right end was at bp 2445682. This shows that a 6,729-bp PAO1 sequence from bp 2438953 to 2445681 is replaced by PAGI-1 in strain X24509. The insertion position of PAGI-1 and the replacement of the PAO1 sequence are diagrammed in Fig. ​Fig.3.3.

Open in a separate window

FIG. 3

Location of PAGI-1 in the genome of P. aeruginosa. Shown are PAGI-1, the replaced 6,729-bp chromosomal segment, and the junction sequences of the two flanking genes and PAGI-1. The cross-hatched bar represents the P. aeruginosa PAO1 genome. The genes within the replaced region are indicated, based on the annotation of the PAO1 sequence. The DNA sequences shown in italics, at the junctions, are derived from PAGI-1.

Sequence analysis and annotation of PAGI-1.

The complete nucleotide sequence of PAGI-1 was determined and the sequence was annotated. PAGI-1 is 48,893 bp in length. The open reading frames (ORFs) of PAGI-1 were predicted using the GeneMark method based on Markov chain models for coding and noncoding regions of P. aeruginosa (14, 17). A total of 51 putative ORFs were predicted, and their organization is shown in Fig. ​Fig.4.4. The protein sequence similarities of the PAGI-1 genes were analyzed using the program based on the BLAST algorithm (NCBI) and the e-motif search developed by Craig G. Nevill-Manning, Thomas D. Wu, and Douglas L. Brutlag, Biochemistry, Stanford University, and the results of this analysis are shown in Table ​Table4.4. Approximately one-half of the genes are either hypothetical unknown or conserved hypothetical unknown genes. Among the genes that could be assigned putative functions, the most notable are the remnants of two transposable elements. Two genes, delineated by orf32-orf33 and orf37-orf38, share high levels of similarity with elements encoding transposases A and B, respectively, which belong to the IS3 family of insertion sequences (19).

Open in a separate window

FIG. 4

Annotation of the PAGI-1 sequence. The cross-hatched region indicates the junction of the island with the chromosome relative to the coordinates in the PAO-1 genome. Also indicated are the locations of the homologues of the pqiA and pqiB genes and probe 2 and probe 3, which were used in the Southern hybridization. The gray arrows indicate the open reading frames in PAGI-1.

Annotation also revealed the presence of two putative transcriptional regulators. orf5 encodes a polypeptide which shows significant similarity to the RpoN-dependent subfamily of regulatory elements and is most closely related to the PrpR of Salmonella enterica serovar Typhimurium (15). The predicted product of orf30 shares similarity with putative regulatory proteins in various Mycobacterium and Streptomyces species. This protein, SrmR, regulates expression of polyketide biosynthetic genes in Streptomyces ambofaciens (9). A number of genes encode various dehydrogenases (orf8, -9, -14, -16, -18, and -23). The left end of PAGI-1 also contains the coding sequence for two proteins that are homologous to paraquat-inducible proteins of E. coli (16). Paralogues of these genes were also identified in the P. aeruginosa genome, PAO4689 and PAO4690, which share 89 and 96% identity with orf2 and orf3, respectively.

The insertion of PAGI-1 is accompanied by deletion of a 6,729-bp region, relative to the PAO1 genome (Fig. ​(Fig.3).3). The five genes which have been deleted (Table ​(Table5)5) include a gene encoding a putative transcriptional regulator of the LysR family (PAO2220) and a gene encoding a transposase (PAO2221) which is homologous to a similar enzyme in Rhizobium sp. strain NGR234. The insertion of PAGI-1 results in the disruption of a gene which specifies a hypothetical protein (PAO2223) at the right junction, leading to the premature termination of the coding sequence of PAO2223 by 187 bp. The left junction between PAGI-1 and the rest of the chromosome is within a gene encoding a homologue of α-ketoglutarte semialdehyde dehydrogenase (PAO2217). This protein is probably unaffected by the presence of PAGI-1, because the PAGI-1 sequence replaces two codons of PAO2217 (GTTGCT) with ATTGAC followed by a termination codon, which gives a polypeptide of identical size but with two different carboxy-terminal amino acids (Val Ala replaced with Ile Asp).

We thank Steve Moseley for critical reading of the manuscript.

This work was supported by grant DK53369 from the National Institutes of Diabetes and Digestive Kidney Diseases and a grant from the Cystic Fibrosis Foundation to the University of Washington Genome Center.