Property talk:P4864
Jump to navigation
Jump to search
Documentation
cutting site of restriction enzyme
DNA cutting site of restriction enzyme, written from 5' to 3'
DNA cutting site of restriction enzyme, written from 5' to 3'
Represents | restriction enzyme (Q219715) | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Data type | String | |||||||||
Domain | restriction enzyme (Q219715) | |||||||||
Allowed values | According to this template:
([ACGTRMWSYKHBDVN]*\^[ACGTRMWSYKHBDVN]*|(\(\d+\/\d+\))?[ACGTRMWSYKHBDVN]+\(\d+\/\d+\)) ; expression methods of cutting sites are according to REBASEAccording to statements in the property:
When possible, data should only be stored as statements([ACGTRMWSYKHBDVN]*\^[ACGTRMWSYKHBDVN]*|(\(-?\d+\/-?\d+\))?[ACGTRMWSYKHBDVN]+\(-?\d+\/-?\d+\)) | |||||||||
Example | EcoRI (Q417754) → G^AATTC SmaI (Q6130415) → CCC^GGG | |||||||||
Tracking: usage | Category:Pages using Wikidata property P4864 (Q126375308) | |||||||||
See also | recognition sequence (P4863), isoschizomer (P4873), neoschizomer (P4875) | |||||||||
Lists |
| |||||||||
Proposal discussion | Proposal discussion | |||||||||
Current uses |
| |||||||||
Search for values |
[create Create a translatable help page (preferably in English) for this property to be included here]
Type “restriction enzyme (Q219715)”: item must contain property “subclass of (P279)” with classes “restriction enzyme (Q219715)” or their subclasses (defined using subclass of (P279)). (Help)
Exceptions are possible as rare values may exist. Exceptions can be specified using exception to constraint (P2303). List of violations of this constraint: Database reports/Constraint violations/P4864#Type Q219715, SPARQL
Format “
Exceptions are possible as rare values may exist. Exceptions can be specified using exception to constraint (P2303). ([ACGTRMWSYKHBDVN]*\^[ACGTRMWSYKHBDVN]*|(\(-?\d+\/-?\d+\))?[ACGTRMWSYKHBDVN]+\(-?\d+\/-?\d+\))
”: value must be formatted using this pattern (PCRE syntax). (Help)List of violations of this constraint: Database reports/Constraint violations/P4864#Format, SPARQL
Scope is as main value (Q54828448): the property must be used by specified way only (Help)
List of violations of this constraint: Database reports/Constraint violations/P4864#Scope, hourly updated report, SPARQLExample SPAPQL query
[edit]You can search restriction enzymes which can recognize the sequence "ACTTGTCATGGCGACTGTCCAGCTTTGTGCCAGGAGCCTCGCAGGGGTTG", for instance, and its cutting site by using regex FILTER (modified from [1]).
SELECT DISTINCT ?enzyme ?enzymeLabel ?recognize ?cut
WHERE
{
?enzyme wdt:P31 wd:Q49695242;
rdfs:label ?enzymeLabel;
wdt:P4863 ?recognize;
wdt:P4864 ?cut;
FILTER (lang(?enzymeLabel) = "en") .
FILTER regex ("ACTTGTCATGGCGACTGTCCAGCTTTGTGCCAGGAGCCTCGCAGGGGTTG", ?recognize)
}